A real-time polymerase chain reaction is a laboratory technique of molecular biology based on the polymerase chain reaction. This technique detects the fluorescence produced by reporter molecules like SYBR® Green dye or TaqMan® probe during the DNA amplification reaction. Compare and contrast between SYBR® Green and TaqMan® probe with illustrations.

A real-time polymerase chain reaction is a laboratory technique of molecular biology based on the polymerase chain reaction. This technique detects the fluorescence produced by reporter molecules like SYBR® Green dye or TaqMan® probe during the DNA amplification reaction. Compare and contrast between SYBR® Green and TaqMan® probe with illustrations.

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter15: Genomes And Genomics

Section: Chapter Questions

Problem 6QP: Which of the following best describes the process of DNA sequencing? a. DNA is separated on a gel,...

See similar textbooks

Similar questions

Examine the DNA fragment sequence below. Your job is to design primers for PCR that would be able to amplify this DNA fragment. Design the primers so that they are 7 bases in length. Don’t forget to indicate direction (polarity) of the primers. Also describe where the primer would bind (i.e. top or bottom strand, left or right side of the DNA strand). Please organize your response so that each primer, and associated information, is separated by at least one blank line 5’ - TCCACTTGCTGTGTAGCTAAATCATATAACAG3’ - AGGTGAACGACACATCGATTTAGTATATTGAC
Why is the company Qiagen has more refined DNA extraction steps than a normal Strawberry DNA extraction practical? Summary of Qiagen DNA extraction steps Add ATL buffer and grind with sample. Add 20 microliters of enzyme Proteinase K to degrade protein into a 1.5-2ml microcentrifuge tube. Add 200 microlitres AL lysis buffer, and mix by vortexing for 5–10 seconds, which breaks cell membrane allowing DNA to be released. Incubate the sample at 56 degrees for 10 minutes. Mix the cell lysate with 200 microlitres ethanol by pipetting it at the side of the microcentrifuge wall so DNA precipitates. The DNA forms a white layer and the remaining liquid is discarded. Pipet the mixture into DNeasy Mini spin column placed in a 2 ml collection tube. Centrifuge for a minute at 8000 rpm. Place the mini spin column into a 2 ml collection tube, add 500 µl Buffer AW1, and centrifuge for 1 min at 8000 rpm. Then add it to a new 2 ml collection tube (provided), add 500 µl Buffer AW1, and centrifuge for 1…
Explain why DNA ladders are usually included during gel electrophoresis. One aspect of PCR that can be modified is the annealing temperature. In general, higher annealing temperatures show more specificity towards a single template, whereas lower annealing temperatures show less specificity and may bind to multiple regions throughout the genome. Discuss how using an annealing temperature that is too high or too low might influence the results of a PCR assay (and gel electrophoresis results) such as the one used in this study.
Labelled primers or dNTPs are useful in some recombinant DNA techniques. What are DNA primers? What labelled primer can be incorporated into DNA primers. Describe the recombinant DNA techniques where these labelled primers or dNTPs are used.
During agarose gel electrophoresis, why does DNA move through the gel when electric current is applied? because DNA is negatively charged because a charged chemical from the loading buffer is bound to the DNA because DNA is positively charged because DNA absorbs electricity
List the steps in the polymerase chain reaction; discuss one disadvantage to this technique
Discuss the following statement: “primase is a sloppy enzyme that makes many mistakes. eventually, the rna primers it makes are disposed of and replaced with dna synthesized by a polymerase with higher fidelity. this is wasteful. it would be more energy-efficient if a dna polymerase made an accurate copy in the first place.”
An optimum ligation reaction should contain approximately 50 ng of vector. Given yourconcentrations recorded below, what is the volume of vector that should be added to eachligation reaction to have this mass of DNA in the reaction? Size of asPink-promoterless in bp: 702 (vector) Size of pCusC in bp: 157 The concentration of digested & purified PCR insert: 13.849 The concentration of digested and purified plasmid: 6.887 Any help with this is appreciated. I'm a bit confused thx
K What is an example of positive feedback? sweating when you are hot increased respiration during exercise decreased blood glucose levels when insulin is released maintenance of blood pH levels labour contractions during birth
For what purposes is DNA extraction done? (give at least 3 purposes for which you may need to extract DNA)
The exponential nature of PCR allows spectacular increases in the abundance of a DNA sequence being amplified. Consider a 10-kbp DNA sequence in a genome of 1010 base pairs. What fraction of the genome is represented by this sequence; i.e., what is the fractional abundance of this sequence in this genome? Calculate the fractional abundance of this target sequence after 10, 15, and 20 cycles of PCR, starting with DNA representing the whole genome and assuming that no other sequences in the genome undergo amplification in the process.
In DNA isolation techniques, a washing step is always done prior to the final resuspension. What is the purpose of this step? In DNA isolation from blood samples, why does the vial for blood storage contain EDTA? In the preparation for DNA isolation in plants, the plant source is refrigerated and ground prior to extraction. Why is this so? Why are DNA pellets air-dried before resuspension in buffer?