A gene includes the sequence AGAACT. When it is transcribed, what will the RNA sequence be? A. UCUUGA B. UGCCGU C. UCUUTC D. TCTTGA

Q: What is the role of transcription in the determination of the amino acid sequence of a polypeptide…

A: Transcription is the initial stage in gene expression, when information from a gene is used to build…

Q: What type of molecule contains the site where amino acids link together to make a polypeptide? a.…

A: Translation is a process of protein synthesis from an mRNA sequence. It occurs in the ribosomal…

Q: A scientist isolates some mRNA from one gene and compares its sequence to that of the gene from…

A: a scientist isolates some mRNA from one gene and compares its sequence to that of the gene from…

Q: 3⁰ A 5 A GC G G A UA A/C UGU P Examine the tRNA above. Which codon on the mRNA strand codes for this…

A: The translation is the process by which polypeptide chain or protein is synthesized from the mRNA…

Q: Which of the structures manufactures rRNA?

A: Introduction rRNA, also called ribosomal RNA is a non-coding RNA that forms the major part of the…

Q: The diagram shows a double-stranded section of DNA. Identify the site of transcription initiation on…

A: Transcription  The process of formation of RNA from DNA with the help of RNA polymerase.

Q: Identify the correct mRNA that will be produced from this NON-TEMPLATE or CODING strand: TAG CCG ATG…

A: The coding strand is the DNA strand whose base sequence is similar to its primary transcript (RNA).…

Q: Which gene regulation event is ONLY present in prokaryotes?  a. transcription level of regulation…

A:

Q: Where in a gene would a 4-bp insertion mutation havethe least effect on gene expression?a. Intronsb.…

A: Mutation is defined as the change in genetic makeup triggered by natural or man made processes. The…

Q: Which RNA types are involved in translation? A. mRNA, tRNA, siRNA B. siRNA, tRNA, rRNA C. tRNA,…

A: Transcription and translation are 2 steps involved in processing of DNA to proteins. RNA molecule is…

Q: A given section of DNA with the sequence TACACTGGTCAT is transcribed. What is the corresponding…

A: Since we know in RNA Thymine is replaced by Uracil. So Adenine is binded to Uracil. This forms the…

Q: Where does the transcription of DNA into mRNA occur in eukaryotes?   A. Nucleus   B. tRNA   C.…

A: The gene expression involves the transcription and translation of gene and mRNA (messenger…

Q: Which statement is true about RNA polymerase (which is required for transcription)? A. RNA…

A: Transcription  It is the process through which the sequences in strand of DNA forms into the…

Q: Which scenario would NOT cause a change to the amino acid that is added to a polypeptide chain? a.…

A: m RNA codes for proteins. This process is called translation.  mutation is change in the DNA…

Q: What are the three phases of creating pre-mRNA? a. Initiation, Elongation and Termination b.…

A: Pre-mRNA, also known as precursor messenger RNA, is the first RNA molecule transcribed from a DNA…

Q: The transcription factor that unwinds DNA to expose the template strand Group of answer choices

A: The conversion of DNA's genetic information into mRNA takes place by a process known as…

Q: Use the codon table shown above to help answer this question. What protein sequence would a cell…

A: The mRNA sequence is: 5' CCAUGCACCAAUAGAUAACCG 3' The Codon is read in triplet form.

Q: How is a fusion protein formed? a. Use CRISPR/Cas9 to remove a portion of the gene of interest,…

A: Fusion proteins:            As the name denotes fusion proteins are proteins formed by combining the…

Q: The sequence of amino acids at the 3’ end of a t-RNA molecule is which of the following? a. UGA b.…

A:

Q: trand of DNA. Question 37 Answer saved Marked out of 1.00 Remove flag Question text A DNA sense…

A: Transcription is referred to as making an RNA copy of a gene sequence from DNA sequence. This copy…

Q: Which enzyme is responsible for the synthesis of pre-mRNA?   A. RNA polymerase I   B. RNA…

A: Correct option is  B.RNA polymerase II The nucleus uses the nucleotide sequence of DNA as a template…

Q: Use the diagram of a gene below to answer the question. The site of transcription initiation of the…

A: In the cytoplasm or endoplasmic reticulum, the process in which ribosomes synthesize proteins after…

Q: D. Which letter in the diagram above best corresponds to the location where exons are found? O A O C…

A: The method of producing RNA copies of a genetic sequence is known as transcription. This duplicate,…

Q: Which of the following codons is called the start codon? a.UAA   b.UGA   c.UAG   d.AUG

A: The connection between the series of nucleotide on mRNA and series of amino acid in the polypeptide…

Q: Serine has the mRNA codons Select one: a. AGU, UCG, and AGC b. UCA, UGA, and UCC c. AGU, AGG, and…

A: Serine is an amino acid (synthesized in the human body) and is present and functional in many…

Q: Which statement BEST DESCRIBES the tRNA structure? A. Amino acids bind to the 5′ end of the tRNA…

A: Introduction: A significant class of ribonucleic acids is called transfer RNA (tRNA). During protein…

Q: how does the E.coli ribosome find the RNA to be translated? A. the sigma factor B. the shine-…

A: SHINE DALGARNO SEQUENCE The ribosome binds to the ribosomal binding site present on messenger RNA in…

Q: If a splice site were mutated so that splicing did not take place, what would be the effect on the…

A: Mutation in genetic sequence of RNA is due to deletion, insertion, or any change in the nucleotides,…

Genome annotation

The technique of linking biological information to genome sequences is termed genome annotation. Gene annotation is the method of identifying gene locations and coding sections. It helps us understand what these genes are doing in the body through establishing structural characteristics and linking them to the actions of various proteins.