7. How many liters of a mouthwash can be prepared from 100 mL of cinnamon flavor if its concentration is to be 0.5% (v/v) in the mouthwash? 8. The formula for 1 liter of an elixir contains 0.25 mL of a flavoring oil. What is the percentage (v/v) of the flavoring oil in the elixir? 9. A dermatologic lotion contains 1.25 mL of liquefied phenol in 500 mL. Calculate the percentage (v/v) of liquefied phenol in the lotion. 10. A lotion vehicle contains 15% (v/v) of glycerin. How much glycerin should be used in preparing 5 gallons of the lotion?

7. How many liters of a mouthwash can be prepared from 100 mL of cinnamon flavor if its concentration is to be 0.5% (v/v) in the mouthwash? 8. The formula for 1 liter of an elixir contains 0.25 mL of a flavoring oil. What is the percentage (v/v) of the flavoring oil in the elixir? 9. A dermatologic lotion contains 1.25 mL of liquefied phenol in 500 mL. Calculate the percentage (v/v) of liquefied phenol in the lotion. 10. A lotion vehicle contains 15% (v/v) of glycerin. How much glycerin should be used in preparing 5 gallons of the lotion?

Biochemistry

9th Edition

ISBN:9781319114671

Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Chapter1: Biochemistry: An Evolving Science

Section: Chapter Questions

Problem 1P

See similar textbooks

Similar questions

Explain well. Asap please
Base on this patient nursing notes please do the questions in the image below and it show be answer exactly please. Pt is a 89 year old, confused, restless, congestive deficit, poor insight and judgment, ineffective coping skills. He frequently throw legs over side rails + visual hallucination to be picking things in the air. Pt has dementia and difficulty sleeping with no effect, fall risk, sit in wheelchair These are the medications the pt is on: trazodone 12.5mg, Olanzepine 2.5 mg
Paraphrase using simple words & please don’t use AI for paraphrasing 1. If you have normal blood pressure, your blood pressure is less than 120/80. The first, or “top” one, is your systolic blood pressure. The second, or “bottom,” one is diastolic blood pressure. 2. Elevated Blood Pressure. Elevated blood pressure is blood pressure that is slightly higher than normal. Diabetes,Unhealthy Diet,Physical Inactivity,Obesity,Too Much Alcohol,Tobacco Use ,Genetics and Family History. 3. 10 ways to control high blood pressure without medication:Lose extra pounds and watch your waistline. Blood pressure often increases as weight increases,Exercise regularly,Eat a healthy diet,Reduce salt (sodium) in your diet,Limit alcohol,Quit smoking,Get a good night's sleep,and reduce stress..
A physician orders 3 grains Phenobarital at bedtime for control of seizures for Mr.I. The Phenoberbital on hand is 60mg/tablet. How many tablets should you administer to Mr. I.
Write a brief note on Local Anesthesia ? Answer should include all pharmacological studies, mechanisms of action, everything which are related to pharmacology? Please write at your own words.
Clinical case: Mrs. P, patient with neurological signs suggesting meningitis . Your 45 year old patient (who has recently moved from Great Britain where sey were born and raised) presents with severe headaches, stiffness in the neck, confusion and drowsiness. • You suspect meningitis, a life threatening infection of the tissue surrounding the brain and spinal cord. • You take a cerebrospinal fluid (CSF) sample from the patient and send it to the micro lab for examination and culturing. • Later that day the micro lab reports that no bacteria nor fungi were observed on a direct smear of the CSF. In 3 days, the lab reports that no The lab also ran PCR for the most common viruses causing meningitis and all were negative. • ELISA's checking for helminth and protozoal infections were also negative. • Blood work suggests there is no immune response to the pathogen causing the patients clinical signs and symptoms. nor fungi grew in cultures. Based on these results, you believe the pathogen…
Please help me! 1. The nurse is preparing to administer Drug Y 300 mg PO daily in equal divided doses every 12 hours. Available is 75 mg/tablet. How many tablets should the nurse administer per dose? Round to the nearest whole number. (Use a leading “0” if it applies. Do not use a trailing “0”. 2. The nurse is preparing to administer Drug X 0.9 g PO to a client. How many mg should the nurse administer? Round to the nearest whole number. (Use a leading “0” if it applies. Do not use a trailing “0”. 3. The nurse is preparing to administer Drug Y 8 mg PO daily divided in two equal doses. Available is 2 mg tablets. How many tablets should the nurse administer per dose? Round to the nearest whole number. (Use a leading “0” if it applies. Do not use a trailing “0”.
Thank you so much! The next question is: Implementation (Take actions) How should the intervention or combination of interventions be performed, requested, communicated, taught, etc.? What are the priority interventions? (Mark with asterisk)
Please do not give solution in image formate thanku. With so many health issues being politicized today, healthcare providers are finding themselves thrust into the tense world of politics and policy. How do you as a manager combat politics and keep patient care the focus of your business?
T3
Implementation (Take actions) How should the intervention or combination of interventions be performed, requested, communicated, taught, etc.? What are the priority interventions? (Mark with asterisk) Thank you so much!
II Log In x b My Que X d.cuny.edu/webapps/assessment/take/take.jsp?course_assessment_id%3 2077934_ 1&course_id%3 2021853 18content id 62810464 18 Remaining Time: 1 hour, 31 minutes, 54 seconds. * Question Completion Status: Moving to the next question prevents changes to this answer. Question 2 AAGTCAAGAAGAAGAAGAAGCC A. The nucleotide sequence above is a STR of how many repeats? B. What sequence is being repeated? For the toolbar, press ALT+F10 (PC) or ALT+FN+F10 (Mac), TTTArial 3 (12pt) E: - L ^ The nucleotide sequence5 above is 5 The sequence being repeated is AAG I 41°F e here to search