4. Which of the following will have an electron configuration ending with 2s 2p°? Choose ALL that apply. a. Argon d. Оxide b. Chloride е. Neon С. Fluoride f. Sulfide

Q: 3. Draw the structure of the DNA oligomer that would perfectly base-pair with the following sequence…

A: DNA has a double stranded structure and both the strands are complementary to each other.  For…

Q: Which structure is NOT present in DNA? * (1 Point) A в D E NH2 NH2 H3C. NH2 B.

A: Option d ( Tryosine has aromatic group)

Q: com X The folding of a protein is a complex and random process. Real Fake ê Abrir en Google…

A: A) Real    The folding of a protein is a complex and random process

Q: (b) Draw the open, Fischer and Haworth Structures of glucose Q 03 (а) How hydrolysis of cellulose…

A: Since you have asked multiple question, we will solve the first question for you. If you want any…

Q: a. Draw a structure showing at least four repeat units of polyacrylonitrile {[CH2-CH(CN)]n}…

A:

Q: Choose the best classification based on the chain length for the monosaccharide shown.

A: The monosaccharides are classified on the based on the number of carbon atoms( or say chain length)…

Q: Please step by step solution and don't use hand raiting please

A: The correct site for attachment of the polysaccharide to a protein is represented by A (OH),…

Q: 5. Classify the following monosaccharides as an aldose or ketose. CHO HO C-H CH2OH HO C-H C=0 HO C-H…

A:

Q: 1. Classify the following fatty acids as as saturated or unsaturated. Which would form fats that are…

A: Given fatty acids,

Q: Most ring fusions in a steroid molecule are: Cis Parallel Trans Anti

A: Steroid molecules generally have a four fused cycloalkane rings. For example cholesterol.

Q: 1. Question 1 Show the chemical reaction that forms a polyester made of maleic acid and propylene…

A: Reaction of Maleic acid and propylene glycol

Q: In polarimetry when lactic acid measured was contaminated with glycerol, what happens to the…

A:

Q: Part A At what pH will the following tripeptide have this structure? H2N-CH %23 CH CH- CH2 CH2 CH2…

A: The above mentioned question is explained below :

Q: Calculate the melting temperature (TM) for the GFP primer- CATGGTCCTGCTGGAGTTCGTG (please give…

A: In DNA sequencing, A compliments T whereas G compliments C ( Chargaff Rule). The formula for…

Q: 11. Paper Production (cont.) Another problem is that water-based inks are absorbed too heavily into…

A: Hello. Since your question has multiple sub-parts, we will solve the first three sub-parts for you.…

Q: Calculate the formula of FeCl3 NH2O if you started with 8.99 g of iron (III) chloride hydrate. After…

A: Given: mass of FeCl3.H2O = 8.99 g mass of FeCl3 = 4.5 g molar mass of FeCl3 = 162.2 g/mol molar mass…

Q: Is there commerical resin similar to RP-46 polyimide resin?

A: Ans:  widely used thermoset polyimide resin comprises PMR-15 and RP-46

Q: 1-proteins-lab-manual?module_item_id=44333 A= abc Where "A" is absorbance, "a" is molar…

A: First question had been answered. Absorbance of a solution can be calculated using Beer Lambert law.

Q: At what pH will the following tripeptide have this structure? H2N-CH- -CH-C- N-CH-C-OH CH2 CH-OH CH2…

A:

Q: Part A Which neutral atom is isoelectronic with each of the following ions: F-, Ca²+, P3+, K+, Pb²+?…

A: Electrons are filled in a different atomic orbital in an atom. According to the Aufbau rule, the…

Q: How many fused rings are there in steriod?

A:

Q: Which of the statements below apply to the following reaction: но NH + HO H -Y NH HO Y- NH H. H20 H.…

A:

Q: What is the difference between dry and wet milling of starch? Which method is given more preference…

A: The dry milling and wet milling are important methods of processing. Distinct co-products are…

Q: -OOCCH₂ HOOCCH, CH₂COOH CH₂COO- *HNCH, CH, NÓH*

A: Let us discuss its structure.

Q: 1. Draw three molecules of ZX3 in the liquid state. In your drawing, indicate (with an arrow) and…

A: Structures of the given molecular formula:

Q: A processed lemon juice is stored at 4 oC and 10 oC in order to compare storage stability. For…

A:

Q: Gel electrophoresis is a method used to separate fragments of biomolecules such as ___________ (DNA,…

A: Gel electrophoresis is a method used to separate fragments of biomolecules such as DNA. After…

Q: 2. a. Which amino acid is this? (might need to look at another amino acid b. Label which of these is…

A:

Q: НОНН С. H,N-C-C-N-C-C-OH НОСН CH;CHCH, HOH H O TITT I H,N-C-C-N-C-C-OH d. H.NCH.CH.CH.СHН H

A: Amino acids are building blocks of proteins. they're concerned with many chemical and biological…

Q: Sketch the structure of a tripeptide composed of D-glucose, D-mannose, and D-galactose (in that…

A: Tripeptide are essentially consists of three amino acids which are linked together by forming to…

Q: A. Circle the peptide bond in this structure. H3N CH- - ܬܐܐܐ || - H N-CH-C-0 CH3

A: A peptide bond, also referred to as an amide bond, is formed between the α-nitrogen atom of one…

Q: What are the correct reaction conditions for the following transformation? НО- P ОН ОН ? D ОН

A: PCC is mild oxidising agent will oxidise alcohol to aldehyde

Q: Glycogen is a branched-chain polymer of α-D-glucose units in which the chain is formed by C1—C4…

A: Polysaccharides contains large number of monosaccharide units joined together through glycosidic…

Q: β-sheets form due to hydrogen bonding between ________, and parallel β-sheets are held together with…

A: Beta sheets are the secondary structure of protein.

Q: Pls help ASAP.

A:

Q: This dipeptide is designated as: *H3N-C- H3C-CH O Leu-Val Olle-Val Val-lle Yal-Leu CH3 18 C-N-C H3C…

A: When two amino acids are joined together, then elimination of water takes place and amide linkage…

Q: Discuss the potential impact of polymorphism on the physicochemical properties of drugs.

A: The potential impact of polymorphism on the physicochemical properties of drugs are

Q: Provides the missing structures Br₂/FeBr3 A CH3CH₂CI AICI3 B

A:

Q: A circular double-stranded DNA molecule contains 4200 base pairs. In solu- tion the molecule is in a…

A: Given: The given molecular is DNA Number of base pairs=4200 Number of pairs in B-form helix= 10.5…

Q: Which statement best explains the chemical differencesbetween DNA and RNA? (a) DNA has two different…

A: DNA and RNA are nucleic acids, that are important for the storage of genetic information and…

Q: (CH21/23) [References] Draw the structure of the major organic product(s) of the reaction. H₂C 1. 2…

A: An arrow always depicts from a region of high electron density to low electron density ; that is…

Q: The structure given below has what type of glycosidic linkage?

A: The carbonyl group of open-chain monosaccharides reacts with the hydroxy group of another carbon of…