4. Which atom with a lone pair in the structure contributes to the resonance property of the nucleotide? Choose the letter of your answer in the structure. 5. How many hydrogen bonds is the structure pointing at E capable of forming? 6. What is the name of the nitrogenous base which is complementary to pair with the nitrogenous base in the structure?

Q: On a sheet of paper , sketch a picture of a dehydration synthesis reaction between two amino acids.…

A: INTRODUCTION Dehydration SynthesisDehydration reactions are quite useful both biologically and…

Q: 4. The interactions on the backbone (not the side chains) contribute to the (circle one):…

A: A protein is a polymer which is formed by a monomer amino acids that are linked together by peptide…

Q: OH 1 ОН F 12 H H CH2 нно CH3 || 5 C 4 7 8 C-N 10 - CÉC C-N-cc2 | - | || | || но CH3 H. нно CH2 11 13…

A: Ans - Peptide bonds are the bonds formed by condensation of carboxyl group of one amino acid with…

Q: 3. Supra-secondary structures of proteins - supercoiled alpha- helix, Greek key, meander, interlock,…

A: Protein: The amino acids are arranged in a long chain and joined to one another by covalent peptide…

Q: 15. 1 1 2 3 What part of the nucleotide represents a nitrogen base?

A: A nucleotide is the fundamental building block of nucleic acid and we know that nucleic acid which…

Q: Secondary (2°) structure in proteins refers to two specific conformations a region of a protein can…

A: Secondary structure refers to regular, recurring arrangements in space of adjacent amino acid…

Q: Structure and Nomenclature Give the ABBREVIATED NAME of the nucleotide in the 3' end. Name the first…

A: There are two types of nucleic acids- DNA and RNA, based on the type of pentose sugar forming the…

Q: red 3.00 ion The nucleic acid from a particular species of bacteriophage is analyzed and found to…

A: The Chargraff rule states that purines and pyrimidines must be present in equal ratios in a DNA…

Q: 11. A polypeptide is making a short a-helix. A typical residue in an a-helix is involved in two…

A: In an alpha helix, each amino acid residue forms hydrogen bonds with the amino acid located three…

Q: Draw the chemical structure of the three components of a nucleotide and then link the three…

A: Nucleotides are monomeric units of the genetically important biopolymers deoxyribonucleic acid and…

Q: 3.Is the OH for the molecule in #2 from the carboxyl group or from the amino group? 4.Is the H for…

A: "Amino Acid" is the term given to organic molecules that are made up of an Amino group, a Carboxyl…

Q: 5. In a portion of polypeptide shown below, which bond is described by o O0 0? А. 1 В. 2 С.3 D. 4 E.…

A: A polypeptide chain is a linear chain of many amino acids.

Q: NH2 N' NH2 HN H,N 'N' CH,OH CH2OH CH,OH H H (H H H H H, ОН H он ОН ОН — Р—ОН ОН -Р-ОН ОН -Р-ОН а) b)…

A: Nucleotides are biomolecules composed of nucleoside and phosphate. They are the monomers that are…

Q: 9. Identify the structures in the following pictures of various features in the structure of HEWL:…

A: A.Quaternary Structure:The quaternary structure of a protein refers to the arrangement and…

Q: How do you draw different amino acids at ph 7? can you show me an example which I can follow to draw…

A: Amino acids are the building blocks of proteins. They are organic compounds that contain a carboxyl…

Q: Which of the following forms of lysine would you expect to predominate at low pH, neutral pH and…

A: Amino acids are building blocks of proteins. They can exist in two different isomers L and D form…

Q: nscript: 3' TACAGTTAAGGCTCCACTGTTA 5' 5' 3' ino Acid Sequence (ex. Met-Trp- and so on) Second letter…

A: The genetic code is the relationship between the sequence of bases in DNA and the sequence of amino…

Q: The AT base pair has hydrogen bonds while the CG base pair has hydrogen bonds   2, 2   2, 3   3, 2…

A: Asked : Hydrogen bonds between the given base pairs

Q: the DNA consists f 2 strnds hold together by which bond?

A: DNA also called deoxy ribo nucleic acid is the genetic material in most you eukaryotic organisms  It…

Q: Examine the structure shown below and answer the following questions: 1. Name the structure (be as…

A: Nucleic acids or nucleotides are usually consists of mainly nitrogen bases, sugar, and phosphate…

Q: 7. The diagram below represents a portion of a deoxyribonucleic acid. 10 sbri odt Which sequence of…

A: DNA is a polynucleotide chain, where it contains a deoxyribose suger, nitrogen base and a phosphate.…

Q: The R group in alanine is –CH3, whereas the R group in aspartic acid is -CH2CO2H. After consulting…

A: Alanine is an α-amino acid that participates in the synthesis of proteins. It contains a carboxylic…

Q: 4. What is the conjugate acid of each of the following bases? (do not include a counterion) (a) H₁…

A: A pair of substances which differ by a  proton (H+) ion is a called conjugate-acid base pair.The…

Q: I CH₂ I CH₂ I H₂N-CH₂ A. O amino acid C O amino acid B amino acid A amino acid E CH₂ I O amino acid…

A: Hydrogen bond is a weak dipole dipole interaction which is a kind of attraction between hydrogen…

Q: How is a dideoxynucleotide different from a deoxynucleotide?

A: The DNA molecule or Deoxyribonucleic Acid is the substance in which all the genetic information of…

Q: 1. Draw the tripeptide: Val-Leu-Met at pH 7 with the N-terminus to the left and C-terminus to the…

A: Amino acids are the monomers of peptides and they have two functional groups like amino group and…

Q: Nucleic acids are polymers of just four different monomers in a linear arrangement. How many…

A: Nucleic acids are the information carrying molecules of the cell, by directing the process of…

Q: 5'-AAGUCCUAGU-3' In the structure above, there are 9 phosphodiester bonds.  This statement is: True…

A: Phosphodiester bonds occurs when two of the hydroxyl groups in phosphoric acid react with hydroxyl…

Q: 3. Please use curved arrows to draw the protonated form (the conjugate acid) of each Lewis base…

A: The protonated form of each Lewis acid is:a)b)

Q: Draw the structure of 2 five-mers (draw backbones with side chains shown as R groups) forming a beta…

A: The secondary structures of proteins are the alpha helix and beta sheets. Alpha helix forms a spiral…

Q: A) Draw the structure and give the name of a nucleotide made of G + ribose. B) Write the…

A: Ribonucleic acid (RNA) is a polymer of ribonucleotides that participate in diverse biological roles…

Q: Which nucleotide is shown in the picture above?

A: A nucleotide is made up of a phosphate group, a sugar and a nitrogenous base. ATP provides energy to…

Q: Amino Acid 2 = V + Y = 11 Name of amino acid 2: Lysine Draw L-amino acid 2 at pH = X = 2 Calculate…

A: Answer 2: The 11 amino acid is called nonsense amino acid. So, the answer is Lysine. The structure…

Q: Identify the following parts of the polypeptide molecule shown below: A. Number each amino acid B.…

A: Proteins are the ultimate products of the genes. DNA is transcribed into m RNA and this is…

Q: Draw the structure of Phe-Ser-Met-Glu, and indicate where the peptide bonds are.

A: Protein is an organic nitrogenous macromolecule that is required for human health. In the human…

Q: 1. Why do proteins become polycations at extremely low pH and become polyanions at very high pH? 2.…

A: Proteins are biological macromolecules formed by monomers of amino acids. The amino acids have side…

Q: How do I determine an amino acid sequence from RNA? I know you start at AUG which is methionine…

A: To determine an amino acid sequence from RNA, the translation machinery makes use of the genetic…

Q: Please draw the structure of the 19 L-a-amino acids and proline in any form, as you prefer. You may…

A: Amino acids are the monomer units that make up polypeptides, that eventually folds to become…

Q: What are the 3 parts of a nucleotide?

A: Deoxyribonucleic acid (DNA) is a molecule which comprises of two polynucleotide chains which are…

Q: 1. Look at the following diagram of a nucleotide, below, and circle and label all three components:…

A: A nucleotide is composed of 3 components;A pentose sugarA nitrogenous baseOne or more phosphate…

Q: 1. Draw an amino acid. Join it to another amino acid via dehydration synthesis to make a dipeptide.…

A: Secondary structure of proteins is stabilised by hydrogen bonding.

Q: Which nucleotide is shown in the picture above?

A: A nucleotide is formed by nitrogenous base, sugar and phosphate. Sugar binds with nitrogenous base…