Just need answer to question 4 133.8.3.8You are a genetic counselor and a couple has come to you for advice. They have a family history ofcancer and are concerned that their unborn third child will also get cancer. They provide you withthe following pedigrees for two different traits relating to defects in the enzymes separase andtopoisomerase:A.SeparasedefectB.Topoisomerasedefect421.4.6.6.9.6.5.5.111213111214151415These two pedigrees represent the same family. Genetic testing shows that individual 4 has onlynonmutant alleles of both genes and individual 12 has only mutant alleles of both genes. Individuals6, 8, 9, 12, and 14 have cancer. The couple just recently learned that their daughter (individual 14)has cancer and has both mutations. In this lab activity, you will use Punnett squares to determinethe probability that the couple's third unborn child will also inherit both mutations and be at riskfor developing cancer..Using Punnett squares, determine the phenotypes of offspring that the following parents couldproduce. For some situations, there could be more than one genotype for at least one of the parents.In these cases, be sure to include Punnett squares for all possibilities, and give the probablilty thattheir third unborn child may be at risk for developing cancer.1. An autosomal recessive trait with an unaffected mother and an affected father.2. An autosomal dominant trait with an affected mother and an unaffected father.3. An X-linked recessive trait with an unaffected mother and an affected father.4. An X-linked dominant trait with an unaffected mother and an affected father.

X linked dominant This type of Inheritance refers to the mutations in the genes that are present on…

Answered: 4. An X-linked dominant trait with an…

Science

Biology

4. An X-linked dominant trait with an unaffected mother and an affected father.

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter15: Genomes And Genomics

Section: Chapter Questions

Problem 14QP

See similar textbooks

Similar questions

The family of a sixth-grade boy in Palo Alto, California, wasinformed by school administrators that he would have to transferout of his middle school because they believed his mutation ofthe CFTR gene, which does not produce any symptoms associatedwith cystic fibrosis, posed a risk to other students at the schoolwho have cystic fibrosis. After missing 11 days of school, a settlementwas reached to have the boy return to school. What ethicalproblems might you associate with this example?
As a genetic counselor, you are asked to assess the risk for a couple with a family history of familial adenomatous polyposis (FAP) who are thinking about having children. Neither the husband nor the wife has colorectal cancer, but the husband has a sister with FAP. What is the probability that this couple will have a child with FAP? Are there any tests that you could recommend to help in this assessment?
The following is a list of mutational changes. For eachof the specific mutations described, indicate which ofthe terms in the right-hand column applies, either as adescription of the mutation or as a possible cause.More than one term from the right column can applyto each statement in the left column.1. an A–T base pair in the wild-type gene ischanged to a G–C pair2. an A–T base pair is changed to a T–A pair3. the sequence AAGCTTATCG is changed toAAGCTATCG4. the sequence CAGCAGCAGCAGCAGCAGis changed toCAGCAGCAGCAGCAGCAGCAGCAG5. the sequence AACGTTATCG is changed toAATGTTATCG6. the sequence AACGTCACACACACATCGis changed to AACGTCACATCG7. the sequence AAGCTTATCG is changed toAAGCTTTATCGa. transitionb. basesubstitutionc. transversiond. deletione. insertionf. deaminationg. X-rayirradiationh. intercalatori. slippedmispairing
11.
As the leading scientist in a biomedical science laboratory, it is a requirement to give advice to your lab assistants when they are having problems with their experiments. What advice would you give to your assistants that are having the following problems: After performing a polymerase chain reaction (PCR) and agarose gel electrophoresis to confirm the presence of the C01 gene of 750bp. 2.1. They observe no band appearing on an agarose gel. What would be your conclusion? 2.2. They observe three bands of different sizes that resemble a smear on the gel. Advice 2.3. They observe a single band on the gel and conclude that the PCR product is an exact copy of the original template DNA. Would you support their condusion? Explain. 2.4. Explain how PCR can be used to detect infectious agents in diagnoses of diseases.
A genetic counsellor is working with a couple who have just had a child who has a debilitating autosomal recessive form of a disease termed epidemolysis bullosa (which causes severe external and internal skin fragility resulting in blistering etc). Neither parent has epidemolysis bullosa, nor does anyone in their families. What should the counsellor say to this couple? OA. "Because no one in either of your families has epidemolysis bullosa, you are not likely to have another baby with epidemolysis bullosa. You can safely have another child." OB. "Because you have had one child with epidemolysis bullosa, you must each carry the allele. Any child you have has a 50% chance of having the disease." OC. "Because you have had one child with epidemolysis bullosa, you must each carry the allele. Any child you have has a 25% chance of having the disease." OD. "Because you have had one child with epidemolysis bullosa, you must both carry the allele. However, since the chance of having an affected…
A cystic-fibrosis mutation in a certain pedigree is due toa single nucleotide-pair change. This change destroys anEcoRI restriction site normally found in this position.How would you use this information in counseling members of this family about their likelihood of being carriers? State the precise experiments needed. Assume thatyou find that a woman in this family is a carrier, and ittranspires that she is married to an unrelated man whoalso is a heterozygote for cystic fibrosis, but, in his case, itis a different mutation in the same gene. How would youcounsel this couple about the risks of a child’s having cystic fibrosis?
Mutations in the HPRT1 gene in humans result in atleast two clinical syndromes. Consult OMIM (www.omim.org) by querying HPRT1; you will only needto look briefly at the top three hits (files #300322,300323, and 308000).a. What is the full name of the HPRT1 enzyme?b. On which chromosome is the HPRT1 gene located?c. Mutations in HPRT1 are associated with two different syndromes. What are these syndromes? Foreach, answer the following questions: (i) What arethe symptoms associated with the syndrome? (ii) Isthe mutant allele that causes the syndrome dominant, recessive, codominant, or incompletely dominant with respect to the normal allele, or do specialconditions apply? (iii) Is the syndrome associatedwith a loss-of-function or a gain-of-function disease allele? (iv) Does the syndrome display allelicheterogeneity? (v) Does the syndrome display locus heterogeneity? (Note: You do not need to understand everything in the OMIM entries to answerthese questions.)
As a genetic counselor, you inform Susan and John that a blood test for cystic fibrosis is available. Would you recommend genetic testing for Susan and John? Explain.
Null mutations are valuable genetic resources becausethey allow a researcher to determine what happens to anorganism in the complete absence of a particular protein. However, it is often not a trivial matter to determinewhether a mutation represents the null state of the gene.a. Geneticists sometimes use the following test forthe nullness of an allele in a diploid organism: If theabnormal phenotype seen in a homozygote for theallele is identical to that seen in a heterozygote(where one chromosome carries the allele in question and the homologous chromosome is known tobe completely deleted for the gene) then the alleleis null. What is the underlying rationale for thistest? What limitations might there be in interpreting such a result?b. Can you think of other methods to determinewhether an allele represents the null state of a particular gene?
Lay out the genetics of Nicholas’s case, including where the mutationoccurred, what exact nucleotide defect was present, why this was aserious type of defect, and why he was so affected by the mutationbut his mother was not.
Based on the following wild type DNA sequence, indicate if each of the mutations should be classified as : insertion, deletion, missense, nonsense, silent (Use the provided Genetic Code table and remember you have been given DNA sequence). Wild Type: AUGAUUCUUAAAAGU Mutant 1: AUGAUUCUUUAAAGU Mutant 2: AUGAUUCUUGAAAGU Mutant 3: AUGAUCCUUAAAAGU Mutant 4: AUGAUCCUAAAAGU Mutant 5: AUGAUCCUUAAACAGU Socond letter Key: Ala = Alanine (A) Arg Arginine (R) Asn = UUU } UAU Tyr UGU UGC Cys UGA STOP UGG Trp UCU UCC UUC Phe Ser Asparagine (N) Asp = Aspartate (D) Cys Cysteine (C) Gin = Glutamine (Q) Glu = Glutamate (E) Gly = Glycine (G) His = Histidine (H) le = Isoleucine (1) Leucine (L) Lys Lysine (K) Met = Methionine (M) Phe = Phenylalanine (F) Pro Proline (P) Ser = Serine (S) Thr Threonine (T) Trp Tryptophan (W) Tyr Tyrosine (Y) - Valine (V) UCA UCG UAA STOP UAG STOP UUA Leu UUG S CCU CC CGU CUU CUC His CGC Arg Leu Pro CAA Gin CGA CCA CCG CUA CUG CGG Leu = AGU AUU AUC } lle AUA ACU ACC ACA Ser AAC…