Using the example above, transcribe the following DNA strand into mRNA and translate that strand into a polypeptide chain, identifying the codons, anticodons, and amino acid sequence. Instructions: Generate the mRNA, codon, anticodon and amino acid sequence. Use 3letter symbols for the amino acids.Remember:DNA to mRNA: G-C; A-TCodon: starts with start codon (AUG), ends with stop codon (UAA.UAG,UGA)Codon to anticodon: G-C; A-UCodon to amino acid: use genetic code (use 3 letter symbols)Example:DNA:mRNA:Codons:GTACGCGTATACCGACATTCCAUGCGCAUAUGGCUGUAAGAUG-CGC-AUA-UGG-CUG-UAAAnticodons: UAC-GCG-UAU-ACC-GAC-AUUAmino Acids: METHIONINE-ARGININE-ISOLEUCINE-TRYPTOPHAN-LEUCINEUsing the example above, transcribe the following DNA strand into mRNA and translate thatstrand into a polypeptide chain, identifying the codons, anticodons, and amino acidsequence. 3. DNA: TACGGGCCTATACGCTACTAC TCATG GATCGGmRNA:Codon:Anitcodon:Amino Acids:4. DNA: GTACGCGTATACCGACATTCmRNA:Codon:Anitcodon:Amino Acids:

The flow of genetic information from DNA to RNA, RNA to protein synthesis is called central dogma.…

Answered: 3. DNA: TACGGGCCTATACGCTACTAC…

Science

Biochemistry

3. DNA: TACGGGCCTATACGCTACTAC TCATGGATCGG mRNA: Codon: Anitcodon: Amino Acids:

Biochemistry

9th Edition

ISBN:9781319114671

Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Chapter1: Biochemistry: An Evolving Science

Section: Chapter Questions

Problem 1P

See similar textbooks

Similar questions

Use the DNA sequence above, list all possible splicing products
What is meant by the universality of the genetic code?
Given the following DNA sequence from the template strand of a given gene: 5'CTTGCGTCACCTAAGACCTGTCATCG3' a) Write the mRNA that will be transcribed from the DNA sequence above (be sure to label the 5' and 3' ends) b) Write the peptide sequence translated from the mRNA produced in part a.
Given the following sequence of a coding DNA strand: AGTTGCGCATGCCAGAGAGGTTCGAGTGCACATAACTTGAG The template DNA strand will have the following sequence written in the conventional manner with no orientation indicators: The corresponding tRNA sequence written in the conventional manner with no orientation indicators will be: After translation was complete, the resulting polypeptide underwent post-translational modification wherein the N-terminal Met residue was removed from the polypeptide. Using one-letter abbreviations, the sequence of the resulting polypeptide is
List three types of noncoding RNA and describe theirfunctions.
Explain the three steps (Codon recognition, peptide bond formation, translocation) in elongation step of translation.
if you have the following sequence of DNA 5' ATTGCGGAGCCTCGAT 3' do the following:
Define Reading frame as they apply to the genetic code
Use the codon table to determine one possible DNA sequence that corresponds to the following amino acids: methionine(Met), tryptophan(Trp), and lysine(Lys), alanine (Ala). In other words, what would the DNA sequence be that would yield the amino acid sequence above. Show your work. Second base of codon U C A VOU UCU UAU UGU UUCJ UCC UAC UGC UUA UCA UAA UGA UUG UCG UAG UGG CUU CCU CAU CGU CUC CCC CAC CGC CUA CCA CAA CGA CUG CCG CAG CGG AUU ACU AAU AGU AUC ACC >Sar AACJ AGC AUA ACA AAA AGA AUG Met ACG AAG AGG Ng GUU GCU GAU GGU GUC GCC GAC GGC Val GUA GCA GAA GGA GUG GCG GAG GGG First base of codon U Phe Leu >Leu Ser >Pro Thr Ala Tyr His Gin Asn Lys Asp Oys Tro Arg 5 MOA SIA V9A C U A Third base of codon
Explain the reasoning establishing that a sequence of three nucleotides (a triplet codon) is the basic unit of the code relating DNA to protein?
Using the example above, transcribe the following DNA strand into mRNA and translate that strand into a polypeptide chain, identifying the codons, anticodons, and amino acid sequence. DNA: A T A C G A A A T C G C G A T C G C G G C G A T T C G G mRNA: Codon: Anticodon: Amino Acids:
If the following nucleotide sequence, CTC/TGT/AAG/ACC/TTT experienced a mutation resulting in the deletion of the second cytosine in the first DNA triplet so the sequence is now CT_/TGT/AAG/ACC/TTT, what would be the amino acid sequence created from this mutated DNA strand? Table of mRNA codons UUA, UUG = leucine AGG, AGA = arginine %3D CAU, CAC = histidine GUU, GÜC, GUA = valine GAA. GAG=glutamic acid GCU, GUA, GUG = alanine GAU, GAC = asparagine GGU, GGC, GGA = glycine UCA, UCU =serine CGU, CGC, CGA = arginine