Using the example above, transcribe the following DNA strand into mRNA and translate that strand into a polypeptide chain, identifying the codons, anticodons, and amino acid sequence. Instructions: Generate the mRNA, codon, anticodon and amino acid sequence. Use 3letter symbols for the amino acids.Remember:DNA to mRNA: G-C; A-TCodon: starts with start codon (AUG), ends with stop codon (UAA.UAG,UGA)Codon to anticodon: G-C; A-UCodon to amino acid: use genetic code (use 3 letter symbols)Example:DNA:mRNA:Codons:GTACGCGTATACCGACATTCCAUGCGCAUAUGGCUGUAAGAUG-CGC-AUA-UGG-CUG-UAAAnticodons: UAC-GCG-UAU-ACC-GAC-AUUAmino Acids: METHIONINE-ARGININE-ISOLEUCINE-TRYPTOPHAN-LEUCINEUsing the example above, transcribe the following DNA strand into mRNA and translate thatstrand into a polypeptide chain, identifying the codons, anticodons, and amino acidsequence. 3. DNA: TACGGGCCTATACGCTACTAC TCATG GATCGGmRNA:Codon:Anitcodon:Amino Acids:4. DNA: GTACGCGTATACCGACATTCmRNA:Codon:Anitcodon:Amino Acids:

The flow of genetic information from DNA to RNA, RNA to protein synthesis is called central dogma.…

Answered: 3. DNA: TACGGGCCTATACGCTACTAC…

Science

Biochemistry

3. DNA: TACGGGCCTATACGCTACTAC TCATGGATCGG mRNA: Codon: Anitcodon: Amino Acids:

Biochemistry

9th Edition

ISBN:9781319114671

Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Chapter1: Biochemistry: An Evolving Science

Section: Chapter Questions

Problem 1P

See similar textbooks

Similar questions

Use the DNA sequence above, list all possible splicing products
What is meant by the universality of the genetic code?
Given the following DNA sequence from the template strand of a given gene: 5'CTTGCGTCACCTAAGACCTGTCATCG3' a) Write the mRNA that will be transcribed from the DNA sequence above (be sure to label the 5' and 3' ends) b) Write the peptide sequence translated from the mRNA produced in part a.
Explain the three steps (Codon recognition, peptide bond formation, translocation) in elongation step of translation.
if you have the following sequence of DNA 5' ATTGCGGAGCCTCGAT 3' do the following:
Define Reading frame as they apply to the genetic code
Explain the reasoning establishing that a sequence of three nucleotides (a triplet codon) is the basic unit of the code relating DNA to protein?
Using the example above, transcribe the following DNA strand into mRNA and translate that strand into a polypeptide chain, identifying the codons, anticodons, and amino acid sequence. DNA: A T A C G A A A T C G C G A T C G C G G C G A T T C G G mRNA: Codon: Anticodon: Amino Acids:
If the following nucleotide sequence, CTC/TGT/AAG/ACC/TTT experienced a mutation resulting in the deletion of the second cytosine in the first DNA triplet so the sequence is now CT_/TGT/AAG/ACC/TTT, what would be the amino acid sequence created from this mutated DNA strand? Table of mRNA codons UUA, UUG = leucine AGG, AGA = arginine %3D CAU, CAC = histidine GUU, GÜC, GUA = valine GAA. GAG=glutamic acid GCU, GUA, GUG = alanine GAU, GAC = asparagine GGU, GGC, GGA = glycine UCA, UCU =serine CGU, CGC, CGA = arginine
Consider the relation between the sequences of DNA, mRNA, tRNA, and the resulting polypeptide. Part 1 of 2 Fill in the bases, codon, anticodon, or amino acid needed to complete the following table that relates the sequences of DNA, mRNA, tRNA, and the resulting polypeptide. For the polypeptide, enter the 3-letter codes of the amino acid residues. DNA informational strand: 5' end AGA ATC CAT CGA GAC AAG 3' end DNA template strand: 3' end TCT TAG GTA GCT CTG TTC 5' end mRNA codons: 5' end AGA AUC CAU CGA GAC ᎪᎯᏳ 3' end tRNA anticodons: UCU UAG GUA GCU CUG UUC Part: 1/2 Part 2 of 2 What is the polypeptide that is generated by this sequence? Write a description of it using 3-letter codes separated by dashes. Note: Reference the Genetic code table for additional information. Arg - Ile - His - Arg - Asp - Lys
Define Nonuniversal codons as they apply to the genetic code
Refer to the genetic code table and the mRNA sequence below to complete this question: U C U G A U G G G C U U U... beginning with the start codon, which amino acids, in order, are coded for by this section of mRNA? A) Thr-Met- Gly B) Met-Gly-Phe C) Ser-Asp-Gly-Leu .