100% 1988 in Yellowstone marked a year of severe drought. Very large fires swept through the park, fueled by attempts of suppression. Surveys indicated that 793,880 acres of land burned. The fires destroyed a large portion of the biological life present in the areas affected by the flames. However, the area was not left completely annihilated. Although charred, the soil remained intact, where seeds, eggs, small mammals, and insects remained alive, yet hidden below ground. Plants and animals were able to recover and return to the area relatively quickly. Based on what you read so far, what type of succession is this (primary or secondary)? How do you know? If it is secondary, what was the major event that caused the change?

100% 1988 in Yellowstone marked a year of severe drought. Very large fires swept through the park, fueled by attempts of suppression. Surveys indicated that 793,880 acres of land burned. The fires destroyed a large portion of the biological life present in the areas affected by the flames. However, the area was not left completely annihilated. Although charred, the soil remained intact, where seeds, eggs, small mammals, and insects remained alive, yet hidden below ground. Plants and animals were able to recover and return to the area relatively quickly. Based on what you read so far, what type of succession is this (primary or secondary)? How do you know? If it is secondary, what was the major event that caused the change?

Biology: The Unity and Diversity of Life (MindTap Course List)

15th Edition

ISBN:9781337408332

Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Chapter48: Human Impacts On The Biosphere

Section: Chapter Questions

Problem 3CT

See similar textbooks

Related questions

Q: Can you please write which letter would be the answer for each question? (a,b,c,d,e,f are the…

A: The building blocks of both DNA and RNA are nucleotides. A nucleotide has a base, a sugar molecule,…

Q: Please identify the two muhsrooms attached in the picture

A: In first picture given mushroom is MYCENA LEAIANA

Q: believe part C is incorrect, can you please review it? part B more clarification please. part A…

A: Colour blindness is an X linked recessive disease which means that mutation in X chromosomes would…

Q: an example of creating de-identified notes or teach me how to make one

A: De-identified notes are reports or records that have had actually recognizable data (PII) eliminated…

Q: The _____________is a NGI database containing 30 millionfront-facing photos of individuals with…

A: Interstate Photo System abbreviated as (IPS)

Q: When answering a writing prompt, you should always be sure to include: [select the two answers that…

A: A good prompt introduces and restricts the writing subject while also giving specific guidance on…

Q: What is the best way to clean their hands, and why? What would be another way to clean their hands?…

A: Raw uncooked bacon contains many bacteria, viruses and parasites . So it is necessary to always…

Q: Name three departments in the Hospital where the mobile X-ray units are used.

A: Mobile x ray units are the machines which can be moved from on place to other to take radiographic…

Q: watch the four minute video: https://www.youtube.com/watch?v=B-nEYsyRlYo Anwer this question:What…

A: It is very important to value life and not only our life but also the life of other living beings.

Q: how long is the wait for the answer

A: Absorption is the process whereby molecules are taken up by cells from the extracellular fluid and…

Q: Sequence A uuucccucuuagaauuaauucguaauauuuaucau uuaaauuuagcucccuccccccauuaauaaauaauu…

A: RNA molecules are formed with the help of template DNA strand in the process transcription with the…

Q: Remaining Time: 43 minutes, 49 seconds. v Question Completion Status: What is the function of…

A: The given diagram is of an earthworm. An earthworm belongs to phylum Annelida, has a tubular shape…

Q: Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an…

A: Gaucher disease is caused by an accumulation of specific fatty compounds in organs, mainly spleen…

Q: Is it possible to get this typed

A: Introduction Antibiotics are the compounds that are used specifically to target and kill bacteria or…

Q: Certain types of sunglasses can cause more harm than good. What could be wrong with inexpensive…

A: Sunglasses are used to exclude any risk to eyes that can occur due to harmful UV rays from the sun.…

Q: which area on the brain shows the most activity in a fmri

A: The brain is the central organ of the nervous system. It is the information processing center of the…

Q: n 2 paragraphs, watch the video on Gym Emergency Procedures and list your 3 takeaways from the video…

A: The video was very informative and I came to know about many new and good things that i was not…

Q: The words with the commas in between them at the bottom of question 5 are the answer choices for…

A: It is the joining together of DNA molecules from two different species .

Q: Poor embryonic development occurs because ____________________________.

A: After fertilization, a single celled diploid zygote is formed, which later develops into…

Q: write the view

A: A frontal plane is a vertical plane which divides the body into anterior and posterior portions.…

Q: could you please identify me the image and explain little bit about it label it how to identify

A: Histology is a branch of anatomy that deals with the microscopic study of tissues and cells. The…

Q: label

A: The mouth, also known as the buccal cavity, is an oval-shaped cavity inside the skull. The two main…

Q: Pregnant women often experience numbness in their fingers and toes. Why? Please, answer on your own…

A: Tingling, numbness, and pain in the hands are common during pregnancy, especially in the last…

Q: For the next question, refer to the following figure:

A: The nervous system has nerves as its functional and fundamental unit. It is studied under the domain…

Q: HDL is a lipid that transports carbohydrates in the blood True False

A: False. HDL (high-density lipoprotein) is a type of lipoprotein that transports cholesterol in the…

Concept explainers

Modes of Nutrition

It is a biological process of providing or obtaining food that is necessary for growth and health. It includes many physiological processes - absorption, ingestion, assimilation, catabolism, excretion, etc. In biology, the science that deals with nutrition's physiological and chemical processes are called "nutritional science."

Question

100%

Read and answer the question in the image.

1988 in Yellowstone marked a year of severe drought.
Very large fires swept through the park, fueled by
attempts of suppression. Surveys indicated that
793,880 acres of land burned. The fires destroyed a
large portion of the biological life present in the areas
affected by the flames. However, the area was not left
completely annihilated. Although charred, the soil
remained intact, where seeds, eggs, small mammals, and insects remained
alive, yet hidden below ground. Plants and animals were able to recover
and return to the area relatively quickly.
Based on what you read so far, what type of succession is this (primary or secondary)? How do
you know? If it is secondary, what was the major event that caused the change?
The area was carefully observed, starting in 1999,

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Explain how the three major types of deserts differin their climate and vegetation. Why are desert ecosystems vulnerable to long-term damage? How dodesert plants and animals survive? Explain how thethree major types of grasslands differ in their climateand vegetation. What is a savanna? Explain howsavanna animals survive seasonal variations in rainfall (Core Case Study). Why is the elephant an important component of the African savanna? DescribeTuy Sereivathana’s efforts to prevent elephants frombecoming extinct in Cambodia. Why have manyof the world’s temperate grasslands disappeared?Describe Arctic tundra and define permafrost?Explain how the three major types of forests differin their climate and vegetation. Why is biodiversityso high in tropical rain forests? Why do most soils intropical rain forests hold few plant nutrients. Whydo temperate deciduous forests typically have a thicklayer of decaying litter? What are coastal coniferousor temperate rain forests? How do most species…
Need to know the answer in 1 and 2 1.) In the past, sometimes Aboriginal Albertans would purposely set prairie fires in the spring in a type of “controlled burn” in order to begin a secondary succession. Explain why this was done, and why this practice is no longer done. 2.) One of the first species to colonize burned forest is fireweed, a plant that makes a tall stalk of fushia-coloured flowers. Conduct an Internet search to find at least two traditional uses of this plant by Aboriginal peoples.
All of em
please answer 28
The image above is a screenshot taken from an online image sharing website, imgur, showing flowers that allegedly grew from the aftermath of the Fukushima Nuclear Powerplant disaster in 2011. Question: “Do you think this post provides strong evidence of the actual conditions of the area?”
Which term describes the process whereby toxic substances increase along trophic levels of an ecosystem? biomassification biomagnification bioentropy heterotrophy
Figure 20.28 In which of the following regions would you expect to find photosynthetic organisms? a. The aphotic zone, the neritic zone, the oceanic zone, and the benthic realm. b. The photic zone, the intertidal zone, the neritic zone, and the oceanic zone. c. The photic zone, the abyssal zone, the neritic zone, and the oceanic zone. d. The pelagic realm, the aphotic zone, the neritic zone, and the oceanic zone.
How would loss of fungi in a forest effect biogeochemical cycles in the area? Nitrogen could no longer be fixed into organic molecules Phosphorus stores would be released for use by other organisms Sulfur release from eroding rocks would cease Carbon would accumulate in dead organic matter and waste.
Coevolution is a termdescribing the influence thattwo organisms occupying thesame niche have on eachother. Sketch a scenariofor coevolution between abacterium and a human livingin the same environment.
The noted microbial ecologist Martin W. Beijerinck has stated:“Everything is everywhere, the environment selects.” Use thisconcept to explain what ultimately determines whether amicroorganism can live in a certain habitat.
C Clever | Portal A Did you firnish your interim? If no x e Edcite Q 14| 2021 SCI_G8_12_MI X A edcite.com/apps/MOElemViewer?assignid%3=nhaadmin_1611780315611&exid%3Dnhaassessmen Use the information below to answer the question. Below is a model that traces the movement of energy and matter within an Amazon rainforest ecosystem. Ocelot Jaguar Carbon dioxide Golden lion Woolly monkey tamarin Long-horned grasshopper Dead-leaf moth Banana plant Bromeliad plant * Fungi Oxygen Review/End Test Flag Options This assignment uses a Viewer designed by Edcite to meet the needs of students to the state assessment provider. As such, the Edcite viewer may diff 2013-2021 Edcite
Animal communities surrounding deep-sea thermal vents appar-ently exist in total independence of solar energy. How is this exis-tence possible?