1. What does the prefix deci- mean?

Q: A bacterial cell in which the F plasmid is integrated into the chromosome is known as     an F-…

A: Hfr cell is defined as high-frequency recombination cell is a bacterium which is a conjugative…

Q: 6. Based on what you know about mutation, what would you expect to happen to genetic variation…

A: The abrupt changes in the DNA sequences is called as mutation. Mutations may be of many types such…

Q: 1. How many codons are there in the Original DNA sequence? 2. How many codons are there in the MRNA?…

A: Introduction  When a DNA gene is disrupted or damaged in such a way that the genetic message carried…

Q: 4. A female recently gave birth while in captivity; however, the paternity of the infant is unclear.…

A: The method that allows genetic material from known and unknown identities to be contrasted is known…

Q: 4. Why does DNA use Thymine instead of Uracil?

A: DNA is the type of nucleic acid, double stranded poly-nucleotide chain which work as the genetic…

Q: 10. Which of the following statement(s) is/ are true for the molecule below? (1) It can be found on…

A: Structure of the monosaccharides can be represented using the Fischer projection or Haworth…

Q: The first genetic test developed for this disease took advantage of a large family of over 2,000…

A: Huntington’s disease is a neurodegenerative disease. The symptoms of the disease start mildly such…

Q: 3. Sickle cell disease is an autosomal recessive genetic disorder that affects the shape of red…

A: a. To determine if the population is in Hardy-Weinberg Equilibrium (HWE), we need to compare the…

Q: DNA repair during meiosis, where one allele is switched for another allele already in the genotype?

A: ANSWER;- Mismatch DNA fix during meiosis, where one allele is exchanged for one more allele…

Q: What is Chargaff's rule and why is it important?

A: Nucleic acid are macromolecule that comprises of DNA and RNA . DNA ( Deoxyribonucleic acid ) is a…

Q: 28. Given the relative proportion of DNA that directly codes for genes, is it reasonable to say that…

A: Introduction :- A gene is a basic unit of heredity in biology, consisting of a sequence of…

Q: 1. How does the idea of the 4D genome help explain normal orderly human cellular and organismal…

A: Genome is a organism's entire and complete set of genetic instructions.

Q: O the deer died the cactus with the thorns is damaged the cactus without the thorns is damaged O the…

A: Plants show different kind of adaptations so as to get acclimatize to their environment. The…

Q: 4. Mechanism of V/J or V/D/J joining B. The major enzymes and steps 1. Recognition, Knick and form…

A: The adaptive immune response is the body's specific defense mechanism against foreign substances,…

Q: 4. DNA, Genes, & Mutations, Alleles - explain in your own words what each term means.

A: DNA - DNA is also known as Deoxyribonucleic Acid. DNA are molecules present inside cell which carry…

Q: 3. A missense mutation results in the presence of a different amino acid than was encoded by the…

A: Sickle cell anaemia is an autosomal recessive disorder.

Q: 8. When oxygen binds to the heme group, by how many angstroms does the Fe2+ appear to shift? 9. How…

A: The heme group is a prosthetic group in oxygen-binding protein. Its primary function is to bind…

Q: 6. One cat has the genotype Ll for long hair while its mate has the recessive genotype ll for…

A: Introduction: The branch of biology that deals with the study of genes is known genetics. The father…

Q: Stem cells have the potential to be used in 3D printing to create specific geometries of specific…

A: Stem cells are the most potent cells which can regenerate into any of the cell types. Modern…

Q: 5)Would you expect mutations to always produce recessive traits? Why or why not?

A: Mutations are sudden inheritable variations that occur in an organism's genetic material due to…

Q: 6. What is a major difference between genetic maps based on recombination frequency and physical…

A: Genetic map Genetic map is made from the recombinant frequency of genetic marker. Genetic map tells…

Q: 13. What are the two noncontractile proteins?

A: Noncontractile proteins are a group of proteins that are not directly involved in the contraction of…

Q: Look up these mutations 1 by 1… vestigial wings, white eyes, sepia eyes, ebony body. For each…

A: Drosophila, commonly known as the fruit fly has large wings, gray body colour and red eyes as the…

Q: The gene frequency between genes are as follows: x and z is 15%; x and y is 3%; x and w is 6%; w and…

A: The allele or gene frequency is defined as the rate at which a particular allele appears within a…

Q: . An alternative form of a gene is called an

A:

Q: 4. Why do the dideoxynucleotides stop DNA extension?

A: The sequences of nucleotides on the DNA strand (dNTPs) constitute the genetic code or genome. The…

Q: 3. Which symbols would you use to represent the genotype of an individual who is lactose tolerant?…

A: Introduction Genetics is a branch of science which deals with the study of gene and inheritance.…

Q: following is an example of epistasis?

A: Epistatis: It is defined as the the action of masking one gene upon expression of another gene. Even…

Q: 6. A particular organism has 46 chromosomes in its karyotype. Which of the following statements is…

A: Specialized reproductive cells called gametes take part in sexual reproduction. Sex cells are…

Q: 5. The genetic evidence for a triple code (three nucleotides are responsible- for one amino acid)…

A: The proteins are produced from the mRNA by the translation process. This function is performed by…

Q: 10. Analyse the following DNA sequences and identify and explain the anomalies you observe. If there…

A: A nucleotide is the most fundamental component of nucleic acids (RNA and DNA). A sugar molecule…

Q: . in the rudimentary immune system of bacteria, a record of fragments of DNA from previous viral…

A: The adaptive immune system of the bacteria is CRISPR cas.  It has a memory of previously attacked…

Q: Segregation refers to which of the following? homolog pairing O recombination ploidy reduction DNA…

A: Chromosome segregation or segregation of genes take place at Anaphase of meiosis. Chromatid…

Q: List the complementary non-coding DNA sequence. CCUGCAGUAUGAAACGCCUGGUAGAAGGUGGGAAGUGGUGCGCCC . . .

A: DNA consist of a double-helical structure where one strand is called a sense strand or non-coding…

Q: Von Gierke´ş disease results from the lack of glucose-6-phosphatase (G6Pase) activity. This causes…

A: The glycogen storage disease is caused due to the absence of the glucose-6-phosphatase enzyme which…

Q: 10. Relative to one of your liver cells, one of your skin cells has, the same function the same…

A: The entire DNA content of a haploid (n) cell in an organism is known as the genome. The production…

Q: following pairs of omosomes homologous? the 23rd pair of chromosomes for a female the 13th pair of…

A: A homologous chromosome is one of two chromosomes usually stated that they are been allowed to share…

Q: Appropriately label all structures provided with leader lines on the model shown below.

A: The respiratory system constitutes a group of organs concerned with breathing (respiration). It is a…

Genetic Evolution

Sexual reproduction produces distinct population variations. Heredity determines the traits and qualities to be passed down to the progeny. Over time, this variation within-species is also affected by the process of human evolution. The study of how genetic variation leads to evolutionary changes is known as genetic evolution. If a trait helps an organism to survive and reproduce, it is more likely to be passed down the generations. It is rare that such traits result in a completely distinct set of traits in descendants than the ancestral population; this can result in the emergence of a new species.