1) The main functiona. This is the only function your program should call explicitlyi. In your program file, the only code not within a function should be thecalling of the main() functionb. This function shouldi. Call the other functionsii. Display the final grade to the userc. This function should take no input arguments and have no return statement2) The getUserGrades functiona. This function should store the user's grades in a listi. As the name suggests1. The return of this function should be a list containing the grades theuser entered2. This function takes no inputPage 1 of 43) The calcNumAverage functiona. This function should calculate the average gradei. As the name suggets1. The return of this function should be the average grade the userentered2. The input to this function should be a list of gradesii. Average Formula1. Mathematically the average of a set of numbers can be expressed as:Sum. This is the sum of all the numbers divided by the total numberСоuntof numbers.4) The numToLetterGrade functiona. This function should convert from a decimal digit to a valid hexadecimal digitb. You should have code related to this function from lab 6i. As the name suggests1. The return of this function should be a letter grade2. This input to this function should be a single grade numberii. Use the following grade breakdown:A100 – 93A-92.9 – 90В+89.9 – 87В86.9 – 83В-82.9 – 8079.9 – 70D69.9 – 60F59.9 – 0 def getUserGrades ():inputsList[]%3Dwhile( ):..return inputsListdef calcNumAverage(gradesList):gradeAverage= 0while( ):..return gradeAveragedef gradeNumToLetter(average):return letterGradedef main():main()Examples:Below are example outputs of a successful program:Number of classes:3Numeric grade: 88.5Numeric grade: 70.3Numeric grade: 96Your average letter grade is: BNumber of classes:2Numeric grade: 94Numeric grade: 86.7Your average letter grade is: B+Number of classes:1Numeric grade: 64.8Your average letter grade is: D

Algorithm : getUserGrades function : Step 1 : declaring the list and initialize loop variable.…

1) The main function a. This is the only function your program should call explicitly i. In your program file, the only code not within a function should be the calling of the main() function b. This function should i. Call the other functions ii. Display the final grade to the user c. This function should take no input arguments and have no return statement 2) The getUserGrades function a. This function should store the user's grades in a list i. As the name suggests 1. The return of this function should be a list containing the grades the user entered This functi

1) The main function a. This is the only function your program should call explicitly i. In your program file, the only code not within a function should be the calling of the main() function b. This function should i. Call the other functions ii. Display the final grade to the user c. This function should take no input arguments and have no return statement 2) The getUserGrades function a. This function should store the user's grades in a list i. As the name suggests 1. The return of this function should be a list containing the grades the user entered This functi

Computer Networking: A Top-Down Approach (7th Edition)

7th Edition

ISBN:9780133594140

Author:James Kurose, Keith Ross

Publisher:James Kurose, Keith Ross

Chapter1: Computer Networks And The Internet

Section: Chapter Questions

Problem R1RQ: What is the difference between a host and an end system? List several different types of end...

See similar textbooks

Similar questions

Create a function called volume The function will calculate the volume of a cube. It will receive 3 integers, length, width and height. It will return the volume as an integer.
Driving costs - functions Learning Objectives Create a function to match the specifications Use floating-point value division Instructions Driving is expensive. Write a program with a car's miles/gallon and gas dollars/gallon (both floats) as input, and output the gas cost for 10 miles, 50 miles, and 400 miles. Output each floating-point value with two digits after the decimal point, which can be achieved as follows: print(f'{your_value:.2f}') Ex: If the input to your program is: 20.0 3.1599 the output is: The gas cost for 10 miles is $1.58 The gas cost for 50 miles is $7.90 The gas cost for 400 miles is $63.20 Your program must define and call the driving_cost() function. Given input parameters driven_miles, miles_per_gallon, and dollars_per_gallon, the function returns the dollar cost to drive those miles. Ex: If the function is called with: 50 20.0 3.1599 the function returns: 7.89975 def driving_cost(driven_miles, miles_per_gallon, dollars_per_gallon) Your program should…
#include#include#includeusing namespace std;// outputHtmlTitle// parameters// This function...void outputHtmlTitle(ofstream & fout, string title){fout << "" << endl;fout << "" << endl;fout << "" << endl;fout << "" << endl;fout << title << endl;fout << "" << endl;}void outputHtmlFooter(ofstream & fout){fout << "" << endl;fout << "" << endl;}void outputHtmlList(ostream & fout, string first, string second, string third){fout << "" << endl;fout << "\t" << first << "" << endl;fout << "\t" << second << "" << endl;fout << "\t" << third << "" << endl;fout << "\t" << endl;}void main(int argc, char * *argv){ofstream htmlFile("myIntro.html");string title;cout << "Please enter the title: ";getline(cin, title);outputHtmlTitle(htmlFile, title);string name;string course1, course2, course3;cout…
# Question 4def costume_rating(costume_color, bling_value): """ Returns a function that calculates the number of candies to return based on the costume color, bling value, and phrase length. Args: costume_color (str): The color of your costume. Must be one of 'blue', 'red', 'green', 'yellow', 'purple', or 'orange'. bling_value (int): Represents how shiny your costume is. Must be a positive integer. Returns: A function that takes in one parameter: phrase (str): The phrase said by the trick-or-treater. >>> costume_rater = costume_rating('blue', 5) >>> costume_rater('19 Character Phrase') 85 >>> costume_rater('e') 0 >>> costume_rater('seven c') 1 >>> costume_rater = costume_rating('orange', 8) >>> costume_rater('hello i want candy') 14 >>> costume_rater = costume_rating('yellow', 5) >>> costume_rater('please give me…
LAB ASSIGNMENTS IMPORTANT: you should complete the PDP thinking process for each program. Turn in items: 1) book_list.py: you can adapt your Chapter 4 book_list.py Lab program. The program summarizes costs of a book list. It uses all of our standard mipo_ex features. This program summarizes a book list. Enter the number of books that you need: In this version of the program you must use pylnputPlus functions to perform all the input validation and for the main() loop decision. Please enter a whole number: three Enter a number greater than 0: 3 Enter the name of book #1: The Mueller Report Enter cost of The Mueller Report, to the nearest dollar: Please enter a whole number: 18 Enter the name of book #2: Educated: A Memoir Adjust your program to allow book prices to include $ and cents. Restrict individual book prices to $100 maxium. Enter cost of Educated: A Memoir, to the nearest dollar: Please enter a whole number: 24 Enter the name of book #3: Becoming Enter cost of Becoming, to the…
LAB ASSIGNMENTS IMPORTANT: you should complete the PDP thinking process for each program. Turn in items: 1) book_list.py: you can adapt your Chapter 4 book_list.py Lab program. The program summarizes costs of a book list. It uses all of our standard mipo_ex features. In this version of the program you must use pylnputPlus functions to perform all the input validation and for the main() loop decision. Adjust your program to allow book prices to include $ and cents. Restrict individual book prices to $100 maxium. • Clearly document, with comments, your use of the pyip functions. This program summarizes a book liat. Enter the number of books that you need: Please enter a whole number: three Enter a number greater than 0: 3 Enter the name of book #1: The Mueller Report Enter cost of The Mueller Report, to the nearest dollar: Please enter a whole number: 18 Enter the name of book #2: Educated: A Memoir Enter cost of Educated: A Memoir, to the nearest dollar: Please enter a whole number: 24…
C++
c++ code Screenshot and code is must
C++ Code: This function will print out the information that has been previously read (using the function readData) in a format that aligns an individual's STR counts along a column. For example, the output for the above input will be: name Alice Bob Charlie ---------------------------------------- AGAT 5 3 6 AATG 2 7 1 TATC 8 4 5 This output uses text manipulators to left-align each name and counts within 10 characters. The row of dashes is set to 40 characters. /** * Computes the longest consecutive occurrences of several STRs in a DNA sequence * * @param sequence a DNA sequence of an individual * @param nameSTRs the STRs (eg. AGAT, AATG, TATC) * @returns the count of the longest consecutive occurrences of each STR in nameSTRs **/ vector<int> getSTRcounts(string& sequence, vector<string>& nameSTRs) For example, if the sequence is AACCCTGCGCGCGCGCGATCTATCTATCTATCTATCCAGCATTAGCTAGCATCAAGATAGATAGATGAATTTCGAAATGAATGAATGAATGAATGAATGAATG and the vector namesSTRs is…
True or false: setInterval() executes a function repeatedly until the interval is cleared by clearInterval() using the ID returned by setInterval(). О а. True O b. False
Probelm part 1: Define a function called common_divisors that takes two positive integers m and n as its arguments and returns the list of all common divisors (including 1) of the two integers, unless 1 is the only common divisor. If 1 is the only common divisor, the function should print a statement indicating the two numbers are relatively prime. Otherwise, the function prints the number of common divisors and the list of common divisors. Complete each to do with comments to expalin your process. Problem part 2: complete the following todo's and make comments to explain each step # TODO: Define the function 'common_divisors' with two arguments 'm' and 'n'. # TODO: Start with an empty list and append common divisors to the list. # TODO: Create a conditional statement to print the appropriate statement as indicated above. Problem part 3: Call the function common_divisors by passing 5 and 38. Your output should look like this: 5 and 38 are relatively prime. # TODO: Call…
language = python