1) It is declared that some ribozymes are tightly bound to proteins. What isn't the function of those proteins? Select one: A) Regulate the enzymatic activities of the ribozyme B) Conduct the enzymatic function of the ribozyme C) Help the RNA fold properly D) Stabilize the RNA and the ribozyme 2) What promotes the histone chaperone - CAF-L aggregation to the replication machinery? Select one: A) Nucleosome tall modification B) sliding DNA clamp C) Clamp Loader D) DNA polymerase

1) It is declared that some ribozymes are tightly bound to proteins. What isn't the function of those proteins? Select one: A) Regulate the enzymatic activities of the ribozyme B) Conduct the enzymatic function of the ribozyme C) Help the RNA fold properly D) Stabilize the RNA and the ribozyme 2) What promotes the histone chaperone - CAF-L aggregation to the replication machinery? Select one: A) Nucleosome tall modification B) sliding DNA clamp C) Clamp Loader D) DNA polymerase

Human Anatomy & Physiology (11th Edition)

11th Edition

ISBN:9780134580999

Author:Elaine N. Marieb, Katja N. Hoehn

Publisher:Elaine N. Marieb, Katja N. Hoehn

Chapter1: The Human Body: An Orientation

Section: Chapter Questions

Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...

See similar textbooks

Similar questions

Which enzyme catalyzes the joining of deoxyribonucleotide triphosphates (dNTPs) in E. Coli? O a) Helicase b) DNA polymerse I O c) RNA polymerase II O d) DNA polymerase III
the difference in primary structure between related tropomyosin informs arises from a) alternative splicing b) C-to-U editing c) farnesylation d) H3K4 methylation e) targetting to secretory vesicles
After several rounds of replication, if COVID19 RNA changes from 5’ GGGUACAUGGUAGCCCCCGUCGAG …. 3’ to 5’ GGGUACAUGGUAGCCCCCGUCGCCCCGUAG …. 3’ Which of the following describes the above event? a) an insertion mutation occurred b) a duplication mutation occurred c) a multi-points mutation occurred d) a point-series mutation occurred e) an inversion mutation occurred
Please answer asap
3)Which of the following statements are true? Choose all that apply a)There are multiple codons possible for nearly all amino acids b)Each stop codon also codes for an amino acid c)Each tRNA will base pair with only one codon d)The start codon also codes for an amino acid e)Each codon in mRNA codes for exactly one amino acid f)Each codon in tRNA codes for exactly one amino acid g)Each anticodon in tRNA pairs with exactly one codon h)Each tRNA carries exactly one type of amino acid
What is the best description of how the two strands are aligned with each other in the double helix of DNA? A) parallel B) anti-parallel C) perpendicular D) cross-linked E) obtuse