Begin the design process

rtf

School

University Of Central Missouri *

*We aren’t endorsed by this school

Course

MISC

Subject

Geography

Date

Oct 30, 2023

Type

rtf

Pages

2

Uploaded by HighnessNarwhal1812

Report
Page 1 HORTICULTURE 5E: LESSON G2–3: The Design Process only. EXPLAININ G Activity: Student Name Beginning the Design Process Instructions: Provide the word or words to complete the following statements. 1. In the design process, consider the lot on which the house sits to be like a/an . 2. A rough sketch of ovals and circles that represent where activities will occur in the landscape is called a/an . 3. The eyes of the viewer tend to follow the outline of the bed patterns. Therefore, designing that are consistent throughout the landscape is important. 4. A/An is a border that outlines where plants will be planted and forms the framework for the design. 5. An imaginary line created by an architectural feature that extends into the landscape is called a/an . 6. On a wall surface lacking architectural features, begin a bed or the distance across the wall. 7. Straight lines drawn degrees to the house reflect the architecture of the home and often lend a formal appearance to the design. 8. Bed patterns consisting of straight lines drawn degrees to the house create a dynamic, asymmetrical design. 9. bed pattern lines are free flowing and give a natural look to the landscape. 10. The minimum size of a patio or deck should be square feet.
11. If the bed pattern style used in the outdoor living area is curved, the patio or deck should have in its outline as well. 12. In the winter months, the sun’s rays hit primarily the wall. 13. At around p.m., the sun reaches its greatest heating capacity. 14. A row of trees or shrubs provides protection for a distance times the height of the plants. 15. Place shade trees within feet of the house to block the rays hitting the west wall between 3:00 p.m. and 5:00 p.m.
Your preview ends here
Eager to read complete document? Join bartleby learn and gain access to the full version
  • Access to all documents
  • Unlimited textbook solutions
  • 24/7 expert homework help

Browse Popular Homework Q&A

Q: What is the p-value of a right-tailed one-mean hypothesis test, with a test statistic of z0=2.1? (Do…
Q: Source: Message to Congress from the Chickasaw Chiefs, July 1783. When our great father the King of…
Q: The information that follows pertains to Richards Refrigeration, Incorporated: At December 31,…
Q: Which equation is a plausible aggregate supply curve? O Y = 250-80r OTT= 2 + 0.3 (Y - 75) Y = 50…
Q: DNA polymerase I functions in DNA replication to: O a. O b. O C. synthesize the RNA primer…
Q: You are creating a learning system for estimating the quality of a product based on written reviews.…
Q: An object experiences a period of constant acceleration of 9 m/s² east. The table below is for that…
Q: The following mRNA is found inside a yeast cell:  5’ ACUAUGCGAGAAAGCAACUACGCCUAA 3’ Write the…
Q: Calculate the annual interest that you will receive on the described bond.   A ​$1000 Treasury bond…
Q: Cancer cells need more DNA synthesis but the NADPH/ NADP* ratio is high. Which of the following…
Q: A block of mass m=2.00kg is attached to a spring of force constant k=500N/m as shown in figure The…
Q: How are the characteristics of depression and bipolar disorder different in older adults, compared…
Q: What is the principle of the Restriction Fragment Length Polymorphism (RFLP) in the diagnosis of…
Q: A plane is given by the equation 5x − 8y + 4z + 9 = 0 a. Find 3 points on the plane b. Find a…
Q: During 2024, its first year of operations, Baginski Steel Corporation reported a net operating loss…
Q: to measure distance between two binary strings. You want the strings to appear similar if they are…
Q: A process cost system would be appropriate for Oa. custom cabinet builder b. natural gas refinery…
Q: what is the full and net reaction of  1. H2O + aluminum 2. H2O + calcium
Q: Using the definition of the scalar product, find the angle between the following vectors. (Find the…
Q: In the 1960s, the Phillips curve was consistent with a positive relationship between inflation and…
Q: Stockholders' Equity (December 31) Common stock-$5 par value, 100,000 shares authorized, 41,406…
Q: 1. What was the temperature at the location of Earth?  2. What was the temperature at the location…