Practice set 9 lecs 14-21

pdf

School

Binghamton University *

*We aren’t endorsed by this school

Course

501

Subject

Biology

Date

Jan 9, 2024

Type

pdf

Pages

Uploaded by ChefTitanium12870

Practice set 9: Covers lectures 14-21 Complete each set of questions as we advance through the course material. Every question in this exam is connected! Chevonne and Darrel have a baby boy named Ben that quickly begins to develop recurrent bacterial respiratory infections. After genetic testing they find out that Ben has common variable immune deficiency (CVIDS). Common variable immune deficiency (CVIDS) is an autosomal recessive genetic illness. Individuals with the disease have two copies of the mutated /rrba allele, located on chromosome 4. Affected individuals do not produce enough antibodies and thus suffer from recurrent bacterial and viral infections. Further genetic testing reveals that: Both Darrel and Chevonne each have one copy of the mutated recessive /rba allele and one normal copy of LRBA. located on chromosome 4. Darrel has one copy of the mutated recessive ¢f allele, located on chromosome 7. Having two mutated recessive c¢f alleles leads to the development of cystic fibrosis. a different genetic illness. Questions 1-2 cover lectures 17-18. 1. One of the respiratory infections that Ben is continuously suffering from is caused by the Moraxella catarrhalis bacteria. Moraxella catarrhalis has a normally operating lac operon system. When there 1s a high concentration of lactose and a low concentration of glucose in the environment, which genes in the lac operon are expressed? a) lacl, lacZ, lacY b) lacl c) lacZ. lacY In addition, when there is a high concentration of lactose and a low concentration of glucose in the environment, which molecules are active? a) CAP b) RNA polymerase c) CAP.cAMP d) CAP, cAMP. RNA polymerase Questions 3-8 cover lectures 14-15. 3. How did Darrel’s sex chromosomes line up at the metaphase plate (metaphase I) during meiosis of his sperm?

Sex chromosomes Non-sex chromosome (autosome) showed for reference. Sex chromosomes Non-sex chromosome (autosome) showed for reference. B Sex chromosomes Non-sex chromosome (autosome) showed for reference. D Sex chromosomes Non-sex chromosome (autosome) showed for reference. 4. The genetic testing also revealed that Ben has two X chromosomes and one Y chromosome (XXY) a condition called Klinefelter’s syndrome. The source of Ben’s Klinefelter’s syndrome was most likely an error during meiosis of Chevonne’s egg. What did the resulting cells of meiosis I look like during meiosis of Chavonne’s egg (that eventually developed into Ben)? A reference. ex chromosore gUtosome) showed fo reference. B gUtosome) showed o reference. qUtosome) showed fo) reference. 5. Remember. both Darrel and Chevonne each have one copy of the mutated recessive /rba gene and one normal copy of LRBA. Darrel also finds out that he is heterozygous for the Widow’s Peak gene, with T representing the dominant allele and t representing the recessive allele. He is also

heterozygous for the double-jointed gene, D/d. All three genes are located at varying distances apart on chromosome 4. as shown in the diagram below. Maternal Paternal copy T copy D a A Chromosome 4 (unreplicated) One cross over event occurs during Darrel’s sperm production. Ben inherits Darrel’s paternal copy of chromosome 4. Therefore, Ben’s chromosome 4 is most likely to contain: a) TDlrba b) tdLRBA c) tdlrba d) TDLRBA 6. Ben grows into a toddler and Chevonne and Darrel want to have another child. They decide to undergo medical reproduction assistance to ensure that the new baby will not have Kleinfelter’s syndrome and/or CVIDS8. They also want to prevent the new baby from being a carrier of cystic fibrosis. (Remember that Darrel has one copy of the mutated recessive ¢f gene, located on chromosome 7.) Darrel’s sperm is analyzed before fertilization. Considering the diagram of Darrel’s chromosome 4 and 7 below...If Darrel’s harvested sperm contains both the /rba allele and the cf allele, which of the following is true regarding how independent assortment occurred during meiosis? (Consider only independent assortment and not crossing over.) Paternal Maternal Paternal copy copy copy BA Chromosome 4 Chromosome 7 (unreplicated) (unreplicated) a) Parental copies of chromosome 4 lined up on the same side of the metaphase plate as chromosome 7. b) Parental copies of chromosome 4 lined up on the opposite side of the metaphase plate as chromosome 7. 7. The harvested sperm described above is discarded and doctors instead use a sperm that contains the following genotype: LRBA CF. Chevonne’s eggs are not analyzed but instead chosen randomly for fertilization (mimicking the typical process of reproduction). In a punnet square of

Your preview ends here

Eager to read complete document? Join bartleby learn and gain access to the full version

Access to all documents
Unlimited textbook solutions
24/7 expert homework help

this cross. how many gametic combination of Darrel’s will need to be represented? How many gametic combinations of Chevonne will need to be represented? a) Darrel: 4. Chevonne: 4. b) Darrel: 4. Chevonne: 2. ¢) Darrel: 1. Chevonne: 2. d) Darrel: 1. Chevonne. 4. 8. What are the chances that their new baby will have CVID8? What are the chances that their new baby will be a carrier for cystic fibrosis? a) 9/16 chance of CVIDS. 3/16 chance of carrying cf. b) 3/16 chance of CVIDS. 1/16 chance of carrying cf. c) 1/2 chance of CVIDS. 1/2 chance of carrying cf. d) 0 chance of CVIDS. 0 chance of carrying cf. Questions 9 covers lecture 21. 9. In addition to the mutation described above, the mutated /rrba allele is also shorter than the normal allele. So scientists can use PCR and gel electrophoresis to detect the presence of the mutated allele. When Ben’s sibling is born, doctors use PCR to confirm that he did not inherit the mutated Irba allele. Which of the following features of PCR ensures that only the Irba gene is amplified and not the entire genome? a) Heating to separate DNA strands b) Gel electrophoresis ¢) Primer design Questions 10-17 cover lectures 16-19. 10. Remember that CVIDS is caused by having two copies of the mutated /rba gene. The normal LRBA gene sequence is: LRBA 3’ CGCTATAGCGGGTACGCGCTCATCGCAAGCTGGATTGTTCCCGGG +1 This is the strand that RNA polymerase binds to. Therefore. it is the a) Coding DNA strand b) Template DNA strand ¢) mRNA strand. 11. At what point does the RNA polymerase begin transcription? a) GGG b) TAC c) CGC

12. What will be the first several ribonucleotides in the resulting mRNA? a) 3" CCCAUGCGC b) 5° CCCAUGCGC c) 3" AUGCGCGAG d) 5" AUGCGCGAG 13. What/where 1s the termination signal? a) UAA b) TAC ¢c) CCCGGG 14. During translation, the aminoacyl tRNA that brings in the corresponding amino acid for the start codon, will enter/bind the site in the ribosome and will contain the anticodon sequence . a) Asite. AUG b) Asite. TAC c) Psite. AUG d) Psite. UAC 15. The normal and mutated /rba gene sequences are: LRBA 3’ CGCTATAGCGGGTACGCGCTCATCGCAAGCTGGATTGTTCCCGGG I +1 Irba 3" CGCTATAGCGGGTACACGCTCATCGCAAGCTGAATTGTTCCCGGG I +1 Locate the point mutation directly following the DNA that codes the start codon. What kind of change will that create in the resulting amino acid chain? (Look at the diagram in the provided PowerPoint slide for an easier-to-read comparison.) a) THR in the normal amino acid chain becomes ALA in the mutated amino acid chain. This will have a mild effect. b) THR in the normal amino acid chain becomes ALA in the mutated amino acid chain. This will have a severe effect. ¢) ARG in the normal amino acid chain becomes CYS in the mutated amino acid chain. This will have a mild effect. d) ARG in the normal amino acid chain becomes CYS in the mutated amino acid chain. This will have a severe effect. 16. The LRBA gene is fully expressed in T and B immune cells. However. although transcribed and translated in white blood cells, the resulting amino acid chain rarely becomes a functional protein. Which of the following regulatory features could be responsible for this?

17. a) Different transcription factors b) Alternative splicing ¢) Intron/exon processing d) RNA interference e) Folding. cutting or destroying Considering only the processes of transcribing and translating the LRBA gene. T cells and white blood cells will have the same. (select all) a) mRNA b) tRNA c¢) rRNA Questions 18-20 cover lectures 18-21. 18. 19. 20. Chevonne and Darrel enroll Ben in a clinical trial which aims to use crispr/cas9 technology to cure CVIDS. The scientists remove lymph (fluid containing immune cells) from Ben’s body and apply the crispr/cas9 system to the immune cells. Then. they return the engineered immune cells to his body. Which of the following descriptions of the crispr/cas9 features is accurate? a) The naturally occurring repair mechanisms in the cell fixed the /rba gene without any adjustments. b) The gRNA was complementary to the /rba gene. The gRNA guided the cas9 to the /rba gene. ¢) In addition to the engineered immune cells. the crispr sequence was also returned to Ben’s body. The scientists involved in the clinal trial are also studying possible epigenetic effects on LRBA/Irba expression, because there are varying degrees of severity of the CVIDS disease. In an experiment with mice, the scientists discovered that CVIDS8 pregnant mice who were exposed to multiple bacterial and viral infections during their pregnancy gave birth to CVIDS babies that had increased expression of /rba. even though their genotype was /rba/lrba. Control babies, those born to CVID8 mothers that were not exposed to infection during pregnancy. had reduced expression of /rba. If transgenerational epigenetic inheritance is operating in this system. which of the following is true of /rba in the experimental babies? Select all a) It had methyl groups attached. b) It had acetyl groups attached to its associated histones. c) Expression will only stay high if mice are also exposed to the same bacterial and viral infections that their mother was exposed to. d) Expression will stay high even if mice are never exposed to the same bacterial and viral infections that their mother was exposed to. During human embryonic development, hox gene HYX turns on during weeks 8-13 and directs the development of the lungs. Which of the following is true of HYX? (select all) a) It encodes the protein that builds lungs. b) It encodes the protein that turns on the genes that encode the proteins that build lungs. c) Itis only contained in the DNA of lung cells. d) Itis contained in the DNA of all cells but only expressed in the lung cells.

Your preview ends here

Eager to read complete document? Join bartleby learn and gain access to the full version

Access to all documents
Unlimited textbook solutions
24/7 expert homework help

Key 1. Answer: A lacl 1s always expressed (unless it’s mutated). So here it will be expressed. Because there 1s lactose in the environment, the lactose will bind to the repressor (product of lacI) and cause it to fall off DNA. So lacZ and lacY will also be expressed. Lactose does not prevent lacl from being expressed, it just changes the shape of the repressor so that it falls off the DNA. 2. Answer: D. When there is low glucose CAP is active and binds to cAMP. RNA polymerase is bound tightly to the promoter. 3. Answer: B. X and Y chromosomes have to replicate before meiosis, just like autosomes do. So B shows that X and Y have replicated and the sister chromatid pairs are lined up opposite their homolog at the metaphase plate during metaphase I of meiosis. A shows metaphase during mitosis. C shows incorrect metaphase during mitosis. or correct metaphase II of meiosis. D shows incorrect metaphase I of meiosis (chromosomes aren’t replicated). 4. Answer: C. Complete meiosis of Chevonne’s egg showed below. You know nondisjunction occurred because Ben has two x chromosomes instead of one. 5. Answer: C. T and D are linked genes so they won’t crossover. But there will probably be a crossover event between them and LRBA/Irba. So the copy of paternal chromosome 4 that goes into the sperm that Ben inherits will probably look like t d /rba. It couldn’t be T D LRBA because we know that Ben gets the recessive /rba from Darrel. 6. Answer: A. The maternal copy of chromosome 4 contains /rba and the maternal copy of chromosome 7 contains cf. If the sperm has both genes, that means that the maternal chromosomes lined up on the same side of the metaphase plate. So parentals for 4 lined up on the same side of the plate as the parentals for 7. 7. Answer: C. The only gametic combination you have to consider for Darrel is LRBA CF. Because only that sperm is used for fertilization. Chevonne’s eggs are chosen at random so since her genotype is LRBA Irba CF CF the only gametes she can make are LRBA CF and Irba CF. That’s two possibilities. 8. Answer: D. Punnet square below:

Chevonne's eggs: Her genotype is LICC. L/I — represents the Irba gene. LC IC C/c represents the cf gene. ' . So there are only two Darrel's sperm: We already ) know the genotype of his Le e Uec p°s’|'_t"|e gametic sperm because it was ¢ :LCoriC chosen. So you don't need to consider any other gametic combinations. Offspring will either be: LLCC or LICC. Neither will carry the cf mutated allele. And neither will have COVIDS, (although 50% will be a carrier for lbra.) 9. Answer: C. The primers flank the gene, which directs DNA polymerase to bind there and copy the strands. DNA polymerase cannot work without the primers. so it cannot just copy an area of the genome. By carefully designing primers to flank the gene, we ensure that only that gene will be amplified. 10. Answer: B. RNA polymerase binds to the template strand of DNA and makes complementary mRNA. 11. Answer: A. This is the +1 site, where RNA polymerase begins transcribing. 12. Answer: B. Transcription starts at the +1 site. The mRNA will be complementary starting at that point. 13. Answer: C. The termination signal is located on the DNA. It is composed of repeating Cs and Gs. ATT codes for mRNA UAA which is the stop codon. The DNA that codes the stop codon is transcribed into mRNA. It plays a role in translation, not transcription. 14. Answer: D. The first aminoacyl tRNA that starts off translation binds to the P site. On one end it carries the amino acid methionine. The codon that codes for methionine is AUG. So the anticodon carried by the tRNA on the other side will be UAC. 15. Answer: D. Severe effect. ARG and CYS are in different categories and have different properties. So the effect will be severe. 16. Answer: E. In white blood cells, LRBA is transcribed and translated. So an amino acid chain is produced. The only option that can prevent an amino acid chain from becoming a functional protein is folding, cutting or destroying. That is a post translational modification. 17. Answer: A, B, C. Even though these cells are different, they are both transcribing and translating the LRBA gene. So they should have the same mRNA for the LRBA gene. They will also have the same sequences of tRNA and rRNA because those are the sequences that are needed for translation. Partial credit was provided for this question. 18. Answer: B. Scientists engineer a gRNA that is complementary to the sequence to be targeted, in this case Irba. The gRNA works with cas9 and guides it to Irba. Then cas9 cuts it. The scientists then add in

Practice set 9 lecs 14-21

Related Documents