MCB 150 Problem set 3

pdf

School

University of California, Berkeley *

*We aren’t endorsed by this school

Course

150

Subject

Biology

Date

Feb 20, 2024

Type

pdf

Pages

Uploaded by SuperFang8305

Problem Set 3 Name: Nathan Perez MCB150, Spring 2024 Student ID: 3037236398 Prof. Barton Your GSI: Mari Due: Feb 9 at 5pm Please feel to discuss these problems with other students, but write your answers independently and in your own words. 1. Draw schematics of an antibody and a TCR, labeling the chains, antigen binding regions, and Fc domain. - 2. Explain why a Fab fragment from an antibody specific for SARS-CoV-2 spike protein may prevent infection of cells but doesn’t promote phagocytosis of the virus. - Fab works as an antigen binding receptor so when SARS-Co-V-2 is present the antibody for it will just bind to the spike protein which enables it to not enter the cells but does not have the ability to engulf cells just neutralize the cells. Fc is responsible for the phagocytosis so without Fc there will be no engulfing happening. 3. Imagine that you have purified populations of B and T cells specific for the SARS-CoV-2 spike protein. You want to study how these cells respond to antigen. When you culture the cells with virus (plus some dendritic cells) you see that both the B and T cells get activated and proliferate. However, when you perform the same experiment but first treat the virus with a cocktail of proteases, only the T cells get activated and proliferate. How can you explain this difference? What does this tell you about the spike-specific B cells that you isolated? - In the first experiment the B and t cells were able to be activated and proliferate because of the dendritic cells added and how B cells bind. B cells are able to directly bind and grab the spike protein while the T cells need the dendritic cells to guide and break down the spike protein for them to be activated. That is why both cells were able to be activated and proliferate. - In the second experiment only the T cells were activated because of the addition of the cocktail of protease. With that being added the spike proteins got cut into smaller pieces which made it easier for the t cells to grab and bind to but not for the B cells since they need the spike proteins to

remain the large size they were. This tells us that B cells can only recognize the full uncut spike protein and are not able to recognize cut up spike proteins. 4. The cells in a lymph node are a mixture of T cells (~50% of total), B cells (~40%), and dendritic cells and macrophages (~10%). B220 is a surface protein expressed by all B cells. There are about twice as many CD4 T cells as CD8 T cells. a) Based on these approximations, draw the 2-parameter flow cytometry plots of lymph node cells stained with antibodies specific for the indicated proteins. Include the percentage of cells in each quadrant. - b) Based on what you learned about MHC expression in Lecture 7, draw the 2- parameter flow cytometry plot of lymph node cells stained with antibodies specific for the indicated proteins. Include the percentage of cells in each quadrant. - c) Assuming that successful generation of a BCR or TCR is required for B cells and T cells to exit the bone marrow or thymus, respectively, draw the 2-parameter flow cytometry plot of lymph node cells from a RAG1-deficient mouse stained with antibodies specific for the indicated proteins. Include the percentage of cells in each quadrant.

- 5. Describe two mechanisms that lead to the production of many distinct antigen receptors from only one IgH gene and two IgL genes. - One mechanism of the IgH gene creates distinct antigen receptors by multiple V,D, and J segments randomly selected and spliced together to create new antigen receptors. There are multiple ways these antigen receptors get formed by different patterns that create either their own unique antigen receptors. - The second is the IgL which only involves the V and J segments without the D segment. Segments are brought together in various combinations which create a large number of unique antigen binding sites. A feature of the light chain are the alpha and beta chains which have their own set of genes that could be used to create unique antigen receptors 6. Predict the relative severity of immune dysfunction in humans with the following mutations. Briefly explain your reasoning. a) inactivating mutations in RAG-1 - This would be the most severe because RAG-1 is needed to do the V(D)J recombination so without one there will be no diversity and recombination. This would lead to the B and T cells not working or being sent out. b) inactivation mutations in TdT - This would be less severe as to having a mutation in RAG-1 because there would still be B and T cell receptors they would just lack diversity c) deletion of the 6 JH segments in the IgH locus - This would be the least severe because this would disrupt the production of B cells receptors and antibodies. 7. As a summer project, you are studying a B cell hybridoma which has one productive heavy chain gene rearrangement on one allele (VHT15 DH1 JH2) and germline configuration on the other chromosome. You sequence the rearranged VDJ gene and obtain the following sequences at the VDJ junction: AAT GAG GTC CTC CCA GGT AGT TGG TTC ACG TTC GGC Asn Glu Val Leu Pro Gly Ser Trp Phe Thr Phe Gly From databases you find the following germline sequences: VH T15 (portion of the coding region and 3' sequences):

Your preview ends here

Eager to read complete document? Join bartleby learn and gain access to the full version

Access to all documents
Unlimited textbook solutions
24/7 expert homework help

...AATGAGGTCCTCCCACAGTGTTACAGAGATCATACAATGAATTACAAAAACC DH1 (5' and 3' sequences): GGTTTTTGTCCGTATCGTAGACACTGTGTACTACAGTAGTACACAGTGGGCTTTGGCTTTACA AAAACC JH2 (5' Sequences and portion of the coding region): GGTTTTTGTAGGGACTAGGAAGGGCCCCATTACACTGTGGTTCACGTTCGGC… “...” at the 5’ or 3’ of the above sequences indicate more coding region sequences exist but are not shown. a) Indicate (by boxing or highlighting the above sequences) the germline coding region of VHT15, the germline coding region of DH1, and the germline coding region of JH2. Hint: start by finding the RSS sequences. b) Using the answers you obtain above in a, indicate (by boxing the above sequences) in your rearranged gene which portions come from the V, D, and J coding segments. c) Indicate (by boxing the above sequences) in your rearranged gene any N/P nucleotides (you don’t have to distinguish between N and P – which is sometimes hard). I am honestly very confused on this problem and don’t know how to go about it but I think I did part a and maybe b correct.

Related Documents

BIOL 135 S23 Week 6 Quiz Assignment.pdf

DNA Procedure.pdf

biol131 hw9 kyle han.pdf

biol131 hw8 kyle han.pdf

biol131 hw7 kyle han.pdf

MCB 150 problem set 2.pdf

BIOL 123 poster.pptx

MCB150Spr24 Problem Set 1.pdf

week 2 chapter 3.docx

fruit fly research paper.docx

Problem Set 3.docx

The Scientific Process.docx

Recommended textbooks for you

3-2-1 Code It

Biology

ISBN:9781337660549

Author:GREEN

Publisher:Cengage

Comprehensive Medical Assisting: Administrative a...

Nursing

ISBN:9781305964792

Author:Wilburta Q. Lindh, Carol D. Tamparo, Barbara M. Dahl, Julie Morris, Cindy Correa

Publisher:Cengage Learning

Biochemistry

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Cengage Learning

Case Studies In Health Information Management

Biology

ISBN:9781337676908

Author:SCHNERING

Publisher:Cengage

Understanding Health Insurance: A Guide to Billin...

Health & Nutrition

ISBN:9781337679480

Author:GREEN

Publisher:Cengage

SEE MORE TEXTBOOKS

Recommended textbooks for you

3-2-1 Code It
Biology
ISBN:9781337660549
Author:GREEN
Publisher:Cengage
Comprehensive Medical Assisting: Administrative a...
Nursing
ISBN:9781305964792
Author:Wilburta Q. Lindh, Carol D. Tamparo, Barbara M. Dahl, Julie Morris, Cindy Correa
Publisher:Cengage Learning
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
Case Studies In Health Information Management
Biology
ISBN:9781337676908
Author:SCHNERING
Publisher:Cengage
Understanding Health Insurance: A Guide to Billin...
Health & Nutrition
ISBN:9781337679480
Author:GREEN
Publisher:Cengage