problem set #2

pdf

School

Glendale Community College *

*We aren’t endorsed by this school

Course

101

Subject

Biology

Date

Feb 20, 2024

Type

pdf

Pages

7

Uploaded by AgentRainCapybara38

Report
- 11 Bio240- Spring 2024 - ProbJem Set #2 - Obemu er- . 150 points possible D N A f om the spike protein (S- J) The drawing below shows a section or double-stranded . r SARS-CoV-2, protein) encoded by aJI coronaviruses, including the coronavirus ( b 2019 The COVID-19) that was tint detected in Wuhan City, C~lna, i? Decem ,~: enz~me 2 spike protein allows viral access to cells using the angaot~nsm co~ver t!tions in the S ACE-2 receptor on the cell surface. You are interested 1n creating m~ . · t . 0 protein gene to stop the virus from being able to Infect cells, th ~:. e;~d;c::::.~r~tein in nature. Below are two possible transcripts that you have ident1 1e o COVID-19. (JO poinu) 5 3' A 8 I +1 - I u - ?s 3' -]S _, d ,._., 5' . a. Box A shows one possible transcribed area of S-protein. In this sc~nario, the RNA polymerase moves from left to right as it transcribes thi~ ~ene. Using the standard numbering system described in lecture, indicate the pos1t1on o~ the first transcribed base and the locations of the highly conserved sections of the promoter. Write these numbers directly above the non-coding strand. b. Box B shows the alternative transcribed area of S-protein. In this scenario, the RNA polymerase moves from right to left as it transcribes this gene. Using the standard numbering system described in lecture, indicate the position of the first transcribed base and the locations of the highly conserved sections of the promoter. Write these numbers directly above the non-coding strand. 2) The following is a segment of Genghis Khan's Y-chromosome D N A that includes the promoter sequence and transcription start site of one of his genes (the sequence is easy to get /Jecause he is responsible for 0. 5 percent of the male population in the world, or roughly 16 mi/Don descendants living today. In other words, one out of every 200 men alive have this exact same DNA j~equence) (8 points): 5 'AGTATATATTCACGATGGMCGACTATCCTGACGTTACCCGACATAGTGACGACGGCATTCGATAT 3' 3'TCATATATMGTGCTACCTTGCTGATAGGACTGCMTGGGCTGTATCACTGCTGCCGTAAGCTATA 5' a. Which strand (upper or lower) is most likely the template strand for the gene? • thf low er ! tt1nd, 1
Obenniller - Bio240 - S rin 150 points possible p g 2024 - Problem Set #2 _ b. • What is the basis for your choice? l<ht\'l o 1-htr ev~i;,r/ofeJ1 for fX<r,()le, h{v, rflttl t 0 x, ~~Jc.~ { .7 )}~ •'~ -t'h P ( e,Y)s Ph fv J s e -.1 1tn Le T ,4,A (/tit) ft (tr/;) (-.7 ( f-td b r f'"'' een \ ?.,t? 1 >id 7S b~.ret \JPStrf'i~ 0 f thP <l"rti11Jlr-1 1 Pi~""" st~r: { ,+e, tt...(' lo ',I er s+rti(1d Serv•5 ~5 f-hf +-e1-1pl(ft .s:rH.e ,"+ c~nt-t;,'11_{ 6c,th 'fro,v,v+er ~~({v'i'/}((7 "'1rl +-rt;'l S.l;riP+-,\,n ~t-tr+ ~if--t, ~h,.lr t~r vr>Ptr Jfr-~11d (4..r1 ""+- l1rt-'f 1 .ft1ut~Lr!~.J:,',I\ 3) The following l> N A sequence is the hypothetical coding strand for the botulism toxin , +-- protein produced by Clostridium botulinum, the most acutely toxic substance known .5 t c:;r-+ >• <' • on earth with a human median lethal dose of ,..,,1/10,000,000 of a gram when injected and about 10 times that amount when inhaled. It derives this lethality by blocking signals between nerves and muscles, sometimes for up to several weeks, also causing paralysis of the muscles that control breathing. However, diluted levels of this toxin can be injected into muscles of the face causing paralysis and reducing wrinkles. Other clinical uses include treating muscle conditions associated with cerebral palsy, multiple sclerosis, stroke and Parkinson's. You want to artificially engineer this protein in the lab for patients (which is much safer than growing C botulinum), but all you have is the one strand of the D N A sequence for it, shown below. (21 points) \ I A-,J 3 ~iAbr ll Tll 4AA- l r,4-GG'4-tA-U6'A- l(, ( Tt,4(; L Ut(;MttttrA-6 tllG I, CATCAGGAGGTTTGATCCTATGGCTGGGAATCGGGACTAAAATTCGGGC l?.) S 'c,tu c AGG A-Gb U v uGAuL l v frv§'" i;L vb&" G.-4 4 v l 66ft l vAA-ft A-vvL 666 L 1 / Write out the template strand directly above the coding strand. Y . Write out the mRNA sequence below the non-template strand. /. Under.line the start and stop codons of the mRNA. Sf lit'f : /t"' 14'!P VI,/, fa Indicate the 5' and 3' ends of each DNA strand and the mRNA 2
Obenniller - Bio240 S • 150 points possible - pnng 202 4 - Problem Set #2 - e. Draw a box around the open reading frame of the mRNA. / Double-underline the Shine-Dalgarno sequence in the mRNA. 46'6,466 / W~te out the amino acid sequence of t~e polypeptide e~coded by this sequence. Indicate the amino and carboxyl termini of the polypeptide. I - rv-r e rN\1 1 ri v.J M~ t- Al" -6 Jf-A!n -Ar.9 - Jt£ P l - t e rt,r,,n v_s 4) Consider the following diagram of a replication fork. It shows only the template strands, not the newly synthesized strands. The 3' end of one strand is labeled (9 points). 1 ...... ...... ............ 3' ~ · -:i' a. Draw an arrow to show the direction in which replication is proceeding. b. Is discontinuous replication occurring on the upper or the lower strand? t J.~ O[{ur.S of) t~ f.ow,r { t"~11d 3
Your preview ends here
Eager to read complete document? Join bartleby learn and gain access to the full version
  • Access to all documents
  • Unlimited textbook solutions
  • 24/7 expert homework help
O 15 b 0 enn!ller - Bi. 0 240 - Spring 2024 - Problem Set #2 - points possible c. tdd ilie newlr synthesized strands to the diagram. Include at least one Okazaki ragment. Indicate the location of RNA primers by using wavy lines. Label the 5' and 3' ends of all strands. 5 ) A double-stranded D N A molecule contains 17% adenosine (A). What is the complete base composition of this molecule (show your work) - (5 points)? 6) Given the following problems in bacterial D N A replication, state which enzyme is most likely defective. Briefly explain your reasoning (12 points). , a. A replication bubble is formed, but DNA synthesis is never initiated • l 'l l k o I- pr, ~liSf or fJN A P 0 Pi/Yl t r<5e II I C b,. fl,, Jt'{ II ' ' \ f\_ I rep I,\ l" ,J., n I n, t, < 1, bh i b. Stretches of RNA bases are found in the newly synthesized DNA. •DN/J P~l-fr"era,sr: l rePl{'-eS Rt/A pr;flp,s w,~" ol/J dvri () 5 (Q Pf t 4 + , 1 1Jf1 '1 c. No replication bubble is fonned. ,;g. dffec.f1've hf{r't,~~c prt,ffrji_{ li'ti ofef),.()} of. PNft ~')cA. thQ f.11rf""'it;,n of c, (('P/,'r 4 :+,·11r) bv~b(e ~r rhr orip/YJ of rePf, 1 ,t;+;o>1 d. Short pieces of DNA rather than the entire replicated chromosome is discovered. • L / 9 'ire 1~ de fecf, 1 ve 7) Consider the following diagrams representing three different D N A molecules. If D N A polymerase III is the only enzyme present, which of these molecules can serve as a substrate for D N A synthesis? For each molecule, explain why it can or cannot serve as a substrate (9 points). a. 5' 11 I I 11 I I I I I I I I I I I 11 11 I I I I I 3' • V\J ,' , , (\ of \rJ,. r I< I b e C J) e O N f'r p O ., i fl\ e ,rt; 5 e \ 11 n '{, " ;- re J Jr,1 .c+rtr,dJ, o()e +" c.d- fS :riwr t/l'ld o"7f f s t-eMf/~ff. (or,J, l i I I I I I I
&I i1 f I t l f I I • I I I ' • ' I i I I I - Obenn~ller - Bio240 - Spring 2024 - Problem Set #2 - 150 points possible 5' T'T"T"T""~~ 3' b. 3'· " II i 11111111 11 11 11 11 11 11 1 5' • Th,'s ~,'11 Wbrk, b<'llvSe +~() lo"-Jer tr",d lerve.5 ~5 feMPl4f(>, ~h,lP +ht vfJf'f', J+r,(tid/w/J-~ ,'¥~ +rte ) 1 fnd 1 ~cl--S ~_s 4 Pr\Me-n f"'\,k;,-,5 ,'+ $ vt+~bte -t-Pr {)Nit t 7 r,+hpf ,y" 3 ' 'T"T""l""T""T'"l~l'""T""l""r-T' 5' C. 5' I II II II II II II 11 1 11 11 1 11 11 1 3 , • ThP Io w~r .trt-r4',r1e,J c C.fJ ~s 1 +e tvi Pl(te 1 6c1+ the v 'f Ptr ~tr-r11d I t\cJc_f J v,'+{ble l' e1Jd .f., r f)('lft p oJtflJe r'i se II/ ~t+er1d, rehder,l)f l \ I I r I V)e f-f t c.,f-/c.1 f ~r DNA J Y {} -Hif ..ft.J O • 8) The table shows the D N A, mR N A, tR N A, and amino acid sequences for part of the coding sequence of a gene (21 points). Transcription is fron1 left to right. Complete the table 5' A- ' b r L 4 G' G ·r· T A A 3' DNA 'v double 3' t 4 L C c; r l l 4 fr y· 1 5' helix S' A V 6' G C A r; c::; t) u n- A 7' mRNA ]' ft L l 6 C C A ~I tRNA V \J anticodon Met A-l 61 i {{'./-op) COOH Amino NH2 acids 9) Draw a diagram of the E. coli protein synthesis machinery during termination (24 points). Include and label the following elements: a. Large ribosomal subunit b. Small ribosomal subunit c. E, P, and A sites d. The tRNA bearing the Jast amino acid added to the polypeptide e. The tRNA bearing the second-to-last amino acid added to the polypeptide f. The polypeptide chain g. mRNA strand h. The release factor 5
- - Bio 340 - Obermill S er - u1nmer A 2 l ' OI6 - Problem Set #1 9 , ---- , <ff f s u ~Vt1, ·,t- f .7/ if e P-lf df Lh~,.,, i ' 10) You are a bioengineer working for Genentech, the first company to artificially engineer a human protein in a bacteria. Your task is to design an artificial bacterial chromosome and put in the human gene for insulin, You have completed the chromosome, but know that in order for it to replicate, it requires f!t least one origin of replication (ori). Of the following three D N A sequences you have available for the ori, which one would be the WORST choice for using in your chromosome? Briefly explain your reasoning (6 points). A) 5'-ATCGAGCGCGACGGGCACGCGCA-3' 3'-TAGCTCGCGCTGCCCGTGCGCGT-5' B) 5'-ATCATATATTTGTATACATATAC-3' 3'-TAGTATATAAACATATGTATATG-5' C) 5'-ATATATTTGCATAAATTTGCATG-3' 3'-TATATAAACGTATTTAAACGTAC-5' • P Ii rt- ,4, b el<" s p +~e o rif n o{: f'ep/i cd-,' '1 .ft~+ v rt( t; h /y h t:· b"f1 dt.lJ lf 0 f G L b Se P ! r.f I (rm +-r~t-;11 f N'{,\--h the P fe dbM i' 'l 'l,rt I-/ ,4- r-r•' c.h .f ¤ C?v' e 'll('.{ rlte1,1hert' 1 dvr 4-? +h.e 9f'f.<+er s~blli'+i of 6L P i:,·cr, whllh <re~a,~fd b'/ throe h 1 cl r, 9 r n ho hd .s lo/llf t.re o .J.-t1 ./--11\/'11 h id r 11 7rn bc1t1tJs 1 1 n 4-t P ,' rs 1 Ylele ss i'H f i'l f -H'f {effr~fi'•n iJt ONA- .r.f-ft,nd.J dvr,'r,.r rrPlic<,l.,'oY1 \n~+;~,1--,'," h ft;(ij;f<-1--e +e M PI d" v t I I ; 2,. + i O 11 f, r p 1v st VJ+h r fi'.J. t; Nett A A L . i i I I
Your preview ends here
Eager to read complete document? Join bartleby learn and gain access to the full version
  • Access to all documents
  • Unlimited textbook solutions
  • 24/7 expert homework help
' 0 I r;::; P- cJ I 0 I I' lH2 , • I:,:- o ,. : l I 0 o 340 - Obermiller S - ummer A 201 ' 6 • Problem Set #I ll) You are of s · k on safari in Namib" b . IC looking Honey Bad er aa ~d you come across a group rang much equipment wit1 s (Mell,vora capensis). You didn't analyzer. You think som you, but you do have a nucleic acid RNA "mad badger" • e may have the dreaded single stranded DNA "badger fever"Vl~us, some may have the single stranded RNA "badger don't v,r?, 8 ' ~ome may have the double stranded bacterial infection ;ar;. virus while others may have a simple different bad • 0 io d o~t, you take samples from five Each row. ters and determi_ne the following base compositions. each b d 10 ,t e table below gives the nucleotide composition of a ger s swab. For each one, determine whether it is DNA or R N A, whether it is single-stranded or double-stranded and what badger disease it has (9 points). Bad er Type of Number Type of Disease %A %0 %T %C %U nucleic acid of strands 1 37 13 37 13 0 2 45 45 5 5 0 I 3 28 22 0 22 28 '2. 4 31 20 31 18 0 I 5 17 38 0 28 17 12) The following shows a very short DNA molecule, only two base pairs long. The 3' and 5' ends of each strand are indicated (16 points). 5' AG 3' 3' TC 5' r l (.ff Redraw this sequence, showing its complete molecular structure, including the deoxyribose sugars, phosphate groups, and the detailed structure of each base. Indicate the locations of the 3' and 5' carbons in each sugar, and use dotted lines to show the locations of the hydrogen bonds connecting the two strands. oH )' 0 s' '-H-'). I 1 • / • ' f-1 0 I o - P: o I • - --- -~o 7 J'iHz- O I o-r= 0

Related Documents

Study Guide, Exam 2 2021.docx
Study Guide, Exam 5 2021.docx
Baby BiO (marketing) 3-2008.doc
BIO_120_Exercise_Nine_Genetics_and_Chewing_the_Starch_Worksheet_V2_F2023.docx
General Biology 1407 Instructor Finals Review.pdf
Gene Biol 1407 Lab Exam 2 Review.pdf
GENE 250 - Week 4 Quiz (ungraded).pdf
FA17109A-8E3D-46EF-AE42-DB82C9EF682A.jpeg
bio post lab 6.docx
Bonus points block 1.docx
Quiz 1 .docx
Lab #4 Hypothesis Falsification Using a Ceratopteris richardii Developmental Mutant Assignment Part
Recommended textbooks for you
Text book image
Biology: The Unity and Diversity of Life (MindTap...
Biology
ISBN:9781337408332
Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Text book image
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Text book image
Biology: The Unity and Diversity of Life (MindTap...
Biology
ISBN:9781305073951
Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Text book image
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
Text book image
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Text book image
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
SEE MORE TEXTBOOKS
Recommended textbooks for you
Text book image
Biology: The Unity and Diversity of Life (MindTap...
Biology
ISBN:9781337408332
Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Text book image
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Text book image
Biology: The Unity and Diversity of Life (MindTap...
Biology
ISBN:9781305073951
Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Text book image
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
Text book image
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Text book image
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
SEE MORE TEXTBOOKS