Concepts of Biology
1st Edition
ISBN: 9781938168116
Author: Samantha Fowler, Rebecca Roush, James Wise
Publisher: OpenStax College
expand_more
expand_more
format_list_bulleted
Textbook Question
Chapter 9, Problem 9RQ
How long would the peptide be that is translated from this MILNA sequence: 5-AUGGGCUACCGA-3?
a. 0
b. 2
c. 3
d. 4
Expert Solution & Answer
Trending nowThis is a popular solution!
Students have asked these similar questions
A number of fragments that will be
formed by cleaving the peptide
Met-Ala-Lys-Met-Arg-Phe-Met-Asn
by using CNBr is
O a. three
O b. four
O c. five
O d. two
Given is the 30 nucleotides in the human gene for hemoglobin (the oxygen-carrying protein in the red blood cells): 5’ TAC-CAC-GTG-GAC-TGA-GGA-CTC-CTC-TTC-AGA 3’
a. What is the complementary strand?
b.Deduce the mRNA in this coding region.
c.What is the amino acid sequence based on this mRNA?
d. A very important mutation in human hemoglobin occurs in this DNA sequence, where the T at nucleotide 20 is replace with an A. The mutant hemoglobin is called sickle cell hemoglobin and is associated with severe anemia. What is the amino acid replacement that results in sickle-cell hemoglobin?
What is the predicted size of the corresponding mature mRNA in base pairs (bp), excluding the 5’ cap and 3’ poly- A tail? a. 220bp b. 295bp c. 140bp d. 435bp
Chapter 9 Solutions
Concepts of Biology
Ch. 9 - Figure 9.10 You isolate a cell strain in which the...Ch. 9 - Which of the following does cytosine pair with? a....Ch. 9 - Prokaryotes contain a ______ chromosome, and...Ch. 9 - DNA replicates by which of the following models?...Ch. 9 - The initial mechanism for repairing nucleotide...Ch. 9 - A promoter is ______. a. a specific sequence of...Ch. 9 - Portions of eukaryotic mRNA sequence that are...Ch. 9 - The RNA components of ribosomes are synthesized in...Ch. 9 - How long would the peptide be that is translated...Ch. 9 - Control of gene expression in eukaryotic cells...
Ch. 9 - Post-translational control refers to: a....Ch. 9 - Describe the organization of the eukaryotic...Ch. 9 - Describe the structure and complementary base...Ch. 9 - How do the linear chromosomes in eukaryotes ensure...Ch. 9 - Transcribe and translate the following DNA...Ch. 9 - Describe how controlling gene expression will...
Additional Science Textbook Solutions
Find more solutions based on key concepts
In shorthorn cattle, coat color may be red, white, or roan. Roan is an intermediate phenotype expressed as a mi...
Concepts of Genetics (12th Edition)
A Slice of pizza has 500 kcal. If we could burn the pizza and use all the heat to warm a 50-L container of cold...
Campbell Biology in Focus (2nd Edition)
S
10. FIGURE EX6.10 shows the velocity graph of a 2.0 kg object as it moves along the x-axis. What is the net ...
Physics for Scientists and Engineers: A Strategic Approach, Vol. 1 (Chs 1-21) (4th Edition)
4. Three groups of nonvascular plants are _______, ______, and _______. Three groups of seedless vascular plant...
Biology: Life on Earth (11th Edition)
Your bore cells, muscle cells, and skin cells look different because a. different kinds of genes are present in...
Campbell Essential Biology (7th Edition)
In your own words, briefly distinguish between relative dates and numerical dates.
Applications and Investigations in Earth Science (9th Edition)
Knowledge Booster
Similar questions
- Which part of a tRNA molecule acts as an amino acid attachment site? a. the 5' end b. the 3' end c. the anticodon d. any of thesearrow_forwardWhich translation factor mediates the aminoacyl-tRNA entry into the A site of the ribosome? A. EF-Tu B. EF-Ts C. EF-G D. IF1arrow_forwardGive only typing answer with explanation and conclusionarrow_forward
- In any given species, there are at least how many types of aminoacyl tRNA synthetases? a. 20 b. 40 c. 100 d. 200arrow_forwardDetermine the identity of the N-terminal amino acid after reconstructing the intact protein. Why is this answer correct and why are the others incorrect? A. Asp B. Ser C. Glu D. Ilearrow_forwardGiven the fragment Ala-Lys-Tyr-Gly-Phe and Leu-Val-Ser-His-Cys-Arg, what is the expected result in both fragments with CuSO4 and NaOH? a. dark violet solution b. light violet solution c. blue solution d. colorless solutionarrow_forward
- Write a possible mRNA sequence that codes for each peptide. a. Ile–Met–Lys–Ser–Tyr b. Pro–Gln–Glu–Asp–Phe c. Thr–Ser–Asn–Argarrow_forwardWhat is the correct amino acid sequence for the mRNA code AUGCCAGUAUGA answer choices A. Tyr-Gly-His B. Met-Pro-Val C. Met-Pro-Ala-Val D. Tyr-Gly-Arg-Hisarrow_forwardWhat is the first amino acid encoded in your protein? A. Methionine B. Asparagine C. Proline D. Cysteine Gene Sequence (5'-to-3'): atggaccacctcggggcgtccctctggccccaggtcggctccctttgtctcctgctcgctggggccgcctgggcgcccccgcctaacctcc cggaccccaagttcgagagcaaagcggccttgctggcggcccgggggcccgaagagcttctgtgcttcaccgagcggttggaggactt ggtgtgtttctgggaggaagcggcgagcgctggggtgggcccgggcaactacagcttctcctaccagctcgaggatgagccatggaag ctgtgtcgcctgcaccaggctcccacggctcgtggtgcggtgcgcttctggtgttcgctgcctacagccgacacgtcgagcttcgtgcccct agagttgcgcgtcacagcagcctccggcgctccgcgatatcaccgtgtcatccacatcaatgaagtagtgctcctagacgcccccgtgg ggctggtggcgcggttggctgacgagagcggccacgtagtgttgcgctggctcccgccgcctgagacacccatgacgtctcacatccgc tacgaggtggacgtctcggccggcaacggcgcagggagcgtacagagggtggagatcctggagggccgcaccgagtgtgtgctgag caacctgcggggccggacgcgctacaccttcgccgtccgcgcgcgtatggctgagccgagcttcggcggcttctggagcgcctggtcg gagcctgtgtcgctgctgacgcctagcgacctggaccccctcatcctgacgctctccctcatcctcgtggtcatcctggtgctgctgaccgtg…arrow_forward
- Which of the following enzymes adds a new amino acid to the growing chain of a protein during protein synthesis? a. aminoacyl-tRNA synthetase b. peptidyl synthetase c. peptidyl transferase d. ribosomal synthetasearrow_forwardWhich statements decribe the function of the protein encoded by this gene CAGATTGTGAAGAGGTCTCTTGA? A. Break point cluster region protein that may function as a GTPase B. A coagulation factor C. An enzyme involved in the breakdown of glycosaminoglycans (GAGs) D. Transcription factor involved in the DNA damage response E. A component of hemoglobin F. A tyrosine kinase G. Serine/threonine kinase involved in the DNA damage response H. A tumor suppressor involved in WNT signalling I. A DNA repair enzyme involved in nucleotide excision repairarrow_forwardGiven the following DNA sequence: ATCGGATCCGGTTAACTATTTAAAGCA a. predict the compliment strand of dna (coding strand) b. predict the transcribed product of the coding strand (mRNA transcript) c. given the genetic code table, predict the amino acid sequence of the transcript d. predict the amino acid sequence if the A underlined became deletedarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax College
Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College