Concepts of Biology
1st Edition
ISBN: 9781938168116
Author: Samantha Fowler, Rebecca Roush, James Wise
Publisher: OpenStax College
expand_more
expand_more
format_list_bulleted
Textbook Question
Chapter 9, Problem 9RQ
How long would the peptide be that is translated from this MILNA sequence: 5-AUGGGCUACCGA-3?
a. 0
b. 2
c. 3
d. 4
Expert Solution & Answer
Trending nowThis is a popular solution!
Students have asked these similar questions
A retrotransposon does NOT contain genes for which polyprotein?
a. gag
b. pol
c. It contains genes for all of these polyproteins
d. env
What is the predicted size of the corresponding mature mRNA in base pairs (bp), excluding the 5’ cap and 3’ poly- A tail? a. 220bp b. 295bp c. 140bp d. 435bp
If a tRNA has an anticodon with the sequence 5′-CAG-3′, which amino acid does it carry?
a. Aspartic acid c. Leucine
b. Valine d. Glutamine
Chapter 9 Solutions
Concepts of Biology
Ch. 9 - Figure 9.10 You isolate a cell strain in which the...Ch. 9 - Which of the following does cytosine pair with? a....Ch. 9 - Prokaryotes contain a ______ chromosome, and...Ch. 9 - DNA replicates by which of the following models?...Ch. 9 - The initial mechanism for repairing nucleotide...Ch. 9 - A promoter is ______. a. a specific sequence of...Ch. 9 - Portions of eukaryotic mRNA sequence that are...Ch. 9 - The RNA components of ribosomes are synthesized in...Ch. 9 - How long would the peptide be that is translated...Ch. 9 - Control of gene expression in eukaryotic cells...
Ch. 9 - Post-translational control refers to: a....Ch. 9 - Describe the organization of the eukaryotic...Ch. 9 - Describe the structure and complementary base...Ch. 9 - How do the linear chromosomes in eukaryotes ensure...Ch. 9 - Transcribe and translate the following DNA...Ch. 9 - Describe how controlling gene expression will...
Additional Science Textbook Solutions
Find more solutions based on key concepts
An express train passes through a station. It enters with an initial velocity of 22.0 m/s and decelerates at a ...
College Physics
Name the components (including muscles) of the thoracic cage. List the contents of the thorax.
Human Physiology: An Integrated Approach (7th Edition)
Your bore cells, muscle cells, and skin cells look different because a. different kinds of genes are present in...
Campbell Essential Biology (6th Edition) - standalone book
A Slice of pizza has 500 kcal. If we could burn the pizza and use all the heat to warm a 50-L container of cold...
Campbell Biology in Focus
Body, Heal Thyself The precision of mitotic cell division is essential for repairing damaged tissues like those...
Biology: Life on Earth with Physiology (11th Edition)
Compare and contrast aerobic respiration, anaerobic respiration, and fermentation.
Microbiology with Diseases by Body System (4th Edition)
Knowledge Booster
Similar questions
- Which part of a tRNA molecule acts as an amino acid attachment site? a. the 5' end b. the 3' end c. the anticodon d. any of thesearrow_forwardWhich translation factor mediates the aminoacyl-tRNA entry into the A site of the ribosome? A. EF-Tu B. EF-Ts C. EF-G D. IF1arrow_forwardGive only typing answer with explanation and conclusionarrow_forward
- The codon UUU in an mRNA molecule which results in phenylalanine being inserted as the protein is made. Which will be a characteristic of this codon? a. The tRNA molecule that binds to the UUU codon must have an AAA anticodon. Nde ba e2? b. UUU could code for both phenylalanine and alanine during translation. c. The aminoacyl-tRNA synthetase for phenylalanine binds only the UUU codon. d. UUU is probably only one of several codons that code for phenylalanine.arrow_forwardIn any given species, there are at least how many types of aminoacyl tRNA synthetases? a. 20 b. 40 c. 100 d. 200arrow_forwardWhat is the correct amino acid sequence for the mRNA code AUGCCAGUAUGA answer choices A. Tyr-Gly-His B. Met-Pro-Val C. Met-Pro-Ala-Val D. Tyr-Gly-Arg-Hisarrow_forward
- A gene contains the sequence CGCATACGGTAC that results in the amino acid sequence arg-ile-arg-tyr. A mutation in this gene removes the first G in the strand.What is true of this mutation's effect on the phenotype?1.It will affect the phenotype because although most of the protein will be identical, the first amino acid will be different.2.It will not affect the phenotype because the protein will be identical to the original protein.3.It will affect the phenotype because all the amino acids past this point will be different from the original protein.4.It will not affect the phenotype because only the first amino acid is different from the original protein.arrow_forwardProcedure This activity will use the Human β-hemoglobin gene, which is mutated in sickle cell anemia, with the following sequences of the first thirty (30) nucleotides: TAC CAC GTG GAC TGA GGA CAC CTC TTC AGA... 1. First transcribe the DNA sequence into the mRNA sequence. 2. Refer to the genetic code to write down the amino acid sequence that these 30 nucleotides encode beginning with the first nucleotide. 3. Generate a random number (1-30) by drawing lots in a bowl. Then locate the DNA nucleotide to "mutate" using the number drawn as the position along the gene. 4. "Roll" the tetrahedron "mutator" dice (see direction below for making the tetrahedron "mutator" dice). Note the letter on the side that is flat on the table. That is the nucleotide that will replace the nucleotide in the DNA at the position decided in the previous step. 5. Write the mutant nucleotide sequence in the row for Mutation 1, then analyze mutation. a. If it is the same nucleotide, write same nucleotide…arrow_forwardGive only typing answer with explanation and conclusion which of these choices represents one possible corresponding mRNA sequence that can be transcribed by RNA polymerase, and later translated by ribosomes from the following DNA template? 5'- CTGTATCCTAGCACCCAAATCGCAT - 3'; A. 5'- CTA GCA CCC AAA TCG CAT TAG - 3', B. 5' - AUG CGA UUU GGG UGC UAG - 3', C. 5' - AUG CGA UUU GGG UGC - 3', D. 5- ATG CGA TTT GGG TCG TAG - 3'arrow_forward
- Which of the following enzymes adds a new amino acid to the growing chain of a protein during protein synthesis? a. aminoacyl-tRNA synthetase b. peptidyl synthetase c. peptidyl transferase d. ribosomal synthetasearrow_forwardWhich statements decribe the function of the protein encoded by this gene CAGATTGTGAAGAGGTCTCTTGA? A. Break point cluster region protein that may function as a GTPase B. A coagulation factor C. An enzyme involved in the breakdown of glycosaminoglycans (GAGs) D. Transcription factor involved in the DNA damage response E. A component of hemoglobin F. A tyrosine kinase G. Serine/threonine kinase involved in the DNA damage response H. A tumor suppressor involved in WNT signalling I. A DNA repair enzyme involved in nucleotide excision repairarrow_forwardWhich of the following is the mRNA coding for the peptide trp-met-gly- ser-his? A. 5'GGUGUAUGGUCUUAC-3' B. 5'-CAUUCUGGUAUGUGG-3' C. 5'-UGGAUGGGUUCUCAU-3' D. 3'-UGGAUGGGUUCUCAU-5' E. cannot be determined since the genetic code is degeneratearrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax College
Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College