Microbiology: An Introduction (13th Edition)
13th Edition
ISBN: 9780134605180
Author: Gerard J. Tortora, Berdell R. Funke, Christine L. Case, Derek Weber, Warner Bair
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 9, Problem 6R
Describe a recombinant DNA experiment in two or three sentences. Use the following terms: intron, exon, DNA, mRNA, cDNA, RNA polymerase, reverse transcriptase.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Transcribe the following DNA sequence. Then translate the resulting mRNA transcript.
GGACTACGTTCAAAAGCCATGGATTCGGTA
Transcription:
Translation:
What would be the result of the following mutations in the DNA sequence above? How would the polypeptide change? How would you characterize this mutation? (Nucleotides are numbered from left to right.)
a) nucleotide number 16 changes from a G to an A
b) nucleotide number 12 changes from an A to a T
c) nucleotide number 8 changes from a G to an A
d) an insertion of a C between nucleotides 14 and 15.
Please answer in short and ASAP .
Give the meanings of the following terms: genomics, functionalgenomics, and proteomics.
Chapter 9 Solutions
Microbiology: An Introduction (13th Edition)
Ch. 9 - Compare and contrast the following terms: a. cDNA...Ch. 9 - Differentiate the following terms. Which one is...Ch. 9 - Some commonly used restriction enzymes are listed...Ch. 9 - Suppose you want multiple copies of a gene you...Ch. 9 - Which enzyme makes the smallest fragment...Ch. 9 - Describe a recombinant DNA experiment in two or...Ch. 9 - List at least two examples of the use of rDNA in...Ch. 9 - You are attempting to insert a gene for saltwater...Ch. 9 - How does RNAi silence a gene?Ch. 9 - Prob. 10R
Ch. 9 - Restriction enzymes were first discovered with the...Ch. 9 - The DNA probe, 3-GGCTTA, will hybridize with which...Ch. 9 - Which of the following is the fourth basic step to...Ch. 9 - The following enzymes are used to make cDNA. What...Ch. 9 - If you put a gene in a virus, the next step in...Ch. 9 - You have a small gene that you want replicated by...Ch. 9 - Pieces of human DNA stored in yeast cells. a....Ch. 9 - A population of cells carrying a desired plasmid....Ch. 9 - Self-replicating DNA for transmitting a gene from...Ch. 9 - A gene that hybridizes with mRNA. a. antisense b....Ch. 9 - Design an experiment using vaccinia virus to make...Ch. 9 - Why did the use of DNA polymerase from the...Ch. 9 - The following picture shows bacterial colonies...Ch. 9 - Prob. 1CAECh. 9 - Using the restriction enzyme ECORI, the following...
Additional Science Textbook Solutions
Find more solutions based on key concepts
How does trandlation differ from transcription?
Microbiology: Principles and Explorations
What are the cervical and lumbar enlargements?
Principles of Anatomy and Physiology
Sea turtles have disappeared from many regions, and one way of trying to save them is to reintroduce them to ar...
Marine Biology (Botany, Zoology, Ecology and Evolution)
Problem Set
True or False? Indicate whether each of the following statements about membrane transport is true (...
Becker's World of the Cell (9th Edition)
Define histology.
Fundamentals of Anatomy & Physiology Plus Mastering A&P with eText - Access Card Package (10th Edition) (New A&P Titles by Ric Martini and Judi Nath)
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Consider the following DNA sequence: -T -- -- If RNA primase used this section of DNA to make a primer, what would be the correct sequence of base pairs (from top to bottom)? T-A-C-C-G-T-T OT-U-C-C-G-U-U OA-T-G-G-C-A-A U-A-C-C-G-U-Uarrow_forwardComplete the following table with the proper terms: Process Molecule made name of monomer Name of template that provides information Direction in which template is read Name of enzyme responsible for synthesis Replication Transcription translationarrow_forwardTranscribe the following strand in Mrna, then translate it into amino acidsarrow_forward
- The following is the base sequence on the coding strand of a DNA molecule. AAT GCC AGT GGT TCG CAC Rewrite the base sequence above and underneath write the base sequence for the template DNA strand. Write the base sequence for the strand of mRNA transcribed from the original strand of DNA or template strand. Remember transcribing means making mRNA from DNA. Write the amino acid sequence translated from this mRNA. Translating means making an amino acid chain from mRNA. A) If the fourth nucleotide in the coding DNA strand was changed from a G to a C, what would be the base sequence of the new strand of mRNA? b) What would the resulting amino acid fragment be? A) If a G were added to the coding DNA strand after the third nucleotide, what would be the base sequence of the resulting mRNA? B) What would the resulting amino acid fragment be?arrow_forwardJackson Wang is a biologist working with the genetics of a thermophilic bacterium. He cloned a heat shock gene from the bacteria for further analysis. After cloning, he isolated the plasmid carrying his gene of interest for sequencing. Jackson finally received the nucleotide sequence of his gene. Explain in detail how he could verify whether the nucleotide sequence matches his gene of interest using the bioinformatics databases available.arrow_forwardA plasmid is a DNA double helix in which the ends of each of the strands of nucleotides are attached to each other, forming a circular DNA molecule. 1) True 2) Falsearrow_forward
- Label the image below with ALL the pertinent information related to gene cloning. Make sure you use the following terms: bacterial plasmid, the gene of interest, recombinant plasmid, restriction enzymes, DNA ligase, insert plasmid into bacteria, cloning of plasmid in culture, etc.)arrow_forwarda) What are vectors? Describe extensively the roles vectors play in genetic engineering? Write short notees on the following: Recombinant DNA, Cloning b) What are restriction enzymes? Describe extensively the roles restriction enzymes play in genetic engineering? Write short notees on the following: Selectable markers, Cloningarrow_forwardTranscribe the following strand in Mrna, then translate it into amino acidsarrow_forward
- Use the three letter code for amino acids. If they stop codon is encountered use the word stop without quotation marks. A set of nucleotides in an original DNA strand reads: CTA CTC TTT. Transcribe the short DNA sequence. Then translate the same sequence. arrow_forwardIn the following table, below each DNA nucleotide, type in the complementary mRNA nucleotides. Then, for each set of three DNA and complementary mRNA nucleotides, use the amino acid chart to translate the nucleotides into amino acids, and type them below. DNA T-A-C A-A-G A-T-G G-G-G A-T-T mRNA Enter Text — Enter Text — Enter Text Enter Text — Enter Text — Enter Text Enter Text — Enter Text — Enter Text Enter Text — Enter Text — Enter Text Enter Text — Enter Text — Enter Text Amino acid Enter Text Enter Text Enter Text Enter Text Enter Textarrow_forwardDEFINE THE FOLLOWING: 1) restriction enzyme 2) plasmid 3) recombinant DNAarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage LearningHuman Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Molecular Techniques: Basic Concepts; Author: Dr. A's Clinical Lab Videos;https://www.youtube.com/watch?v=7HFHZy8h6z0;License: Standard Youtube License