EBK BIOLOGY
5th Edition
ISBN: 9780100667976
Author: Maier
Publisher: YUZU
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 9, Problem 3AAATB
Summary Introduction
To write:
The site at which the restriction enzymes cuts the DNA.
Introduction:
Genome is defined as the complete genetic material that is present in an organism. It consists of the coding as well as the non-coding parts of DNA. The study of the genome is termed as genomics. Restriction enzymes are widely used enzymes in the field of genomics. This enzyme was discovered by three scientists named “Werner Arber, Hamilton Smith, and Daniel Nathans”.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
The partial sequence of one strand of a double-stranded DNA molecule is
5'-GACGAAGTGCTGCAGAAAGTCCGCGTTATAGGCATGAATTCCTGAGG
-3'
EcoRI is a restriction enzyme that cleaves after G in the sequence 5'-GAATTC-3'. PstI is a restriction enzyme that cleaves after
A in the sequence 5'-CTGCAG-3'.
Write the sequence of both strands of the DNA fragment created when this DNA is cleaved with both EcoRI and PstI. The first
strand of your duplex DNA fragment should be derived from the given strand sequence.
5'-
-3'
3'-
-5'
For the DNA sequence shown, indicate the products of its cleavage with the following restriction endonucleases (AKA restriction enzymes):5′-ACAGCTGATTCGAATTCACGTT-3′3′-TGTCGACTAAGCTTAAGTGCAA-5′a) EcoRI (the recognition sequence and cleavage site is G↓AATTC);b) AluI (the recognition sequence and cleavage site is AG↓CT).
You plan to clone exon 11 of the HEXA gene (Section C) into the multiple cloning site (MCS) of the
plasmid vector pUC19 illustrated below. You PCR amplify only the 184 bp DNA region representing
exon 11 of HEXA from human DNA as a blunt-ended dsDNA fragment, and purify the amplicon.
Next you digest the vector pUC19 with the restriction enzyme (RE) Smal to obtain linear plasmid
DNA. You mix the PCR product and linear plasmid, add some DNA ligase enzyme in an appropriate
buffer, and incubate overnight at 16°C. The ligation mixture is used to transform competent E. coli
cells, which are subsequently streaked out onto agar plates containing ampicillin, X-gal and IPTG.
HEXA exon 11 sequence:
attcagccagacacaatcatacaggtgtggcgagaggatattccagtgaactatatgaaggagctggaactggtc
accaaggccggcttccgggcccttctctctgccccctggtacctgaaccgtatatcctatggccctgactggaag
gatttctacatagtggaacccctggcatttgaag
PUC 19 plasmid map:
2686 1
Amp
0
lacZ
EcoRI (390)
Smal (410)
BamHI (420)
MCS
Kpnl (430)
LacR binding site
Plac
Pstl…
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Define about Alu family (the name is based on the presence of DNA sequences recognized by the restriction endonuclease AluI)arrow_forwardThe sequence of the coding strand of a bacterial gene is given below. The positions of the first nine bases are numbered for your convenience. A missense mutation was introduced at position seven where the C was changed to a T resulting a mutant gene. 123456789 5'- ATGGCCCGACCGCAACTTTTCCGAGCTCTGGTGTCTGCGCAGTGACC-3 a. Write the template DNA (complementary strand) sequence for the wild type gene above b. Write the DNA sequence of the mutant gene (Both DNA strands) c. Write the sequence of mRNA produced from the mutant gene d. Write the sequence of the mutant protein using the codon usage table provided in the end of this document.arrow_forwardWrite the base sequence of the DNA template from whichthis RNA sequence was derived: GUAUCAAUGAACUUG.How many amino acids are coded for in this sequence?arrow_forward
- Why would you NOT expect a restriction endonuclease to exist that would recognize the site AAGGAA?arrow_forwardGiven below is the DNA template. What are the gene products? 3’ TACCGGCCTATCTAGGGCCATGGCTTAATTCCC 5’ 5’ ATGGCCGGATAGATCCCGGTACCGAATTAAGGG3’arrow_forwardGiven the following double-stranded fragment of DNA: 5'- ACTTGGCAGGCCTTCGATCC-3' 3'- TGAАССGTCСGGAAGCTAGG-5' A hypothetical restriction endonuclease recognizes a 6bp sequence with two-fold symmetry (typical for restriction enzymes) found in this fragment and catalyzes cleavage of this DNA on both strands between GG nucleotides within the recognition sequence. This nuclease exhibits b-type cleavage (atypical for restriction enzymes). Draw the double-stranded sequence of each fragment after cleavage showing any phosphates left on the ends.arrow_forward
- Given the DNA sequence of the restriction enzyme: gi|6329444|dbj|AB034757.1| Hynobius retardatus mRNA for larval beta-globin, complete cds GCAGAATCTGACTCAAGAAATCCCTCCTCACCCAACACCACCAGCAGCCATGGTTCACTGGACAGCAGAGGAGAAGGCAGCCATCAGCTCTGTGTGGAAGCAGGTGAACGTGGAGAGCGATGGACAGGAGGCCCTGGCCAGGTTGCTGATCGTCTACCCCTGGACCCAGAGATACTTCAGCTCTTTTGGGGACCTGTCGAGCCCAGCTGCCATTTGTGCCAACGCCAAGGTCCGTGCCCATGGCAAGAAGGTCCTGTCCGCCCTGGGAGCCGGCGCCAACCACCTGGATGACATCAAAGGCAACTTTGCTGATCTGAGCAAGCTTCACGCAGACACACTCCATGTGGACCCCAATAACTTCCTGCTCCTGGCAAACTGCCTGGTGATCGTCTTGGCCCGCAAGCTGGGAGCCGCCTTCAACCCTCAAGTCCATGCGGCCTGGGAGAAGTTCCTGGCCGTCTCCACCGCGGCTCTGTCCAGAAACTACCACTAGAGACTGGTCTTTGGGTTTAATTCTGTGAACGTCCCTGAGACAAATGATCTTTCAATGTGTAAACCTGTCATTACATCAATAAAGAGACATCTAACAAAAAAAAAAAAAAAAAAAAAAAAAA Identify two blunt-end cutters Identify two sticky-end cutters. For each, Provide the sequence of the Restriction enzyme, Highlight using a specific color where the DNA sequence where the restriction enzyme will cut the DNA Indicate the…arrow_forwardA 10 kb DNA fragment digested with the restriction endonuclease EcoRI yields fragments of 4 kb and 6 kb. When the 10 kb fragment is digested with BamHI, three fragments of 1, 3.5 and 5.5 kb are generated. Digestion with both enzymes yields four fragments of 0.5, 1, 3 and 5.5 kb. Draw the restriction map for the 10 kb fragment based on the data. Label the cut sites for the two enzymes, and the lengths between the cut sites.arrow_forwardThe recognition sequence for the restriction enzyme TaqI is T↓CGA. Indicate the products of the reaction of TaqI with the DNA sequence shown.arrow_forward
- The restriction enzyme Smal recognizes the following sequence and cuts it once between the G and C: 5'.cc| 5'.CCC GGG.3' 5'CCCGGG..3' 3'.GGGCC.5' 3'.GGG CC..5' In the following sequence, in how many places will Smal cut? 5' TAGCATCCCGGGACGCTACCCGGGAAA 3' 3' ATCGTAGGGCCCTGCGATGGGCCCTTT 5' O A.1 OB 2 OC 3 OD.4arrow_forwardThe partial sequence of one strand of a double-stranded DNA molecule is5′ – – – GACGAAGTGCTGCAGAAAGTCCGCGTTATAGGCATGAATTCCTGAGG – – – 3′The cleavage sites for the restriction enzymes EcoRI and PstI are shown below.Write the sequence of both strands of the DNA fragment created when this DNA is cleaved with both EcoRI and PstI. The top strand of your duplex DNA fragment should be derived from the strand sequence given abovearrow_forwardConsider the following DNA template: 5’-AAGAGGTTCCAATGCAGGCACTCACCAACTCTTAAATAAA-3’ 3’-TTCTCCAAGGTTACGTCCGTGAGTGGTTGAGAATTTATTT-5’ If the bottom DNA strand is used as template to transcribe mRNA, predict the amino acid sequence that would result from the process of translation. Met-Ala-Leu-Thr-Gln-Glu-Gly Met-Gly-Ser-Leu-Asn-Ser-Gln Met-Thr-Asn-Ser-Leu-Ala-Gln Met-Gln-Ala-Leu-Thr-Asn-Ser Met-Glu-Ala-His-Trp-Ser-Tyrarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax CollegeHuman Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage LearningBiology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning
- Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning
Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY