EBK BIOLOGY
EBK BIOLOGY
5th Edition
ISBN: 8220100667978
Author: Maier
Publisher: PEARSON
Question
Book Icon
Chapter 9, Problem 2LTB
Summary Introduction

To write:

The amino acid sequence produced from the mRNA nucleotide sequence CAACGCAUUUUG.

Introduction:

The mRNA consists of many bases. A collection of three bases that has the capability to code for a particular amino acid is called codon. Codons are present in the mRNA. These codons attach with the anticodon part of tRNA to synthesize amino acid. The anticodon part of tRNA is complementary to the codon part of mRNA. As a result, these two join together and undergo a process called translation to produce amino acids.

Blurred answer
Students have asked these similar questions
Use the following DNA sequence, and write the resulting messenger RNA sequence TACTTTGAATGCGGCCGTATC?
The following RNA sequence represents a small messenger which can be translated in a prokaryotic cell: 5'-ACGAAUGCACAGUAAAACUGGCUAGCGUAGGCUGA-3 Assume that the messenger RNA is translated in the cell, using the correct machinery and signals required for accurate protein synthesis. Using this RNA sequence and the Genetic Code Dictionary (see your textbook for the dictionary), solve the following problems A. Write the sequence of a protein that would be translated from this mRNA, using the appropriate stop and start signals, and indicating the correct termini of the protein product. B. Suppose that the underlined A in the sequence is changed to a U. Write the expected protein product of this mRNA.
Determine the amino acid sequence for a polypeptide coded for by the following mRNA transcript (written 5'-> 3'): AUGCCUGACUUUAAGUAG
Knowledge Booster
Background pattern image
Similar questions
SEE MORE QUESTIONS
Recommended textbooks for you
Text book image
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Text book image
Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning