Concept explainers
Eukaryotic genomes are replete with repetitive sequences that make genome assembly from sequence reads difficult. For example, sequences such as CTCTCTCTCT .(tandem repeats of the dinucleotide sequence CT) are found at many chromosomal locations, with variable numbers (n) of the CT repeating unit at each location. Scientists can assemble genomes despite these difficulties by using the paired-end sequencing strategy diagrammed in Fig. 9.9. In other words, they can make libraries with genomic inserts of defined size, and then sequence both ends of individual clones.
Following are 12 DNA sequence reads from six cloned fragments analyzed in a genome project. 1A and 1B represent the two end reads from clone 1, 2A and 2B the two end reads from clone 2, etc. Clones 1–4 were obtained from a library in which the genomic inserts are about 2 kb long, while the inserts in clones 5 and 6 are about 4 kb long. All of these sequences have their 5′ ends at the left and their 3′ ends at the right. To simplify your analysis, assume that these sequences together represent two genomic locations (loci; singular locus), each of which contains a (CT)n repeat, and that each of the 12 sequences overlaps with one and only one other sequence.
1A: CCGGGAACTCCTAGTGCCTGTGGCACGATCCTATCAAC
1B: AGGACTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCT
2A: GTTTTTGAGAGAGAGAGAGAGAGAGAGAGACCTGGGGG
2B: ACGTAGCTAGCTAACCGGTTAAGCGCGCATTACTTCAA
3A: CTCTCTCTCTCTCTCTCTCTCAAAAACTATGGAAATTT
3B: TAGTGATAGGTAACCCAGGTACTGCACCACCAGAAGTC
4A: GGCCGGCCGTTGTTGACGCAATCATGAATTTAATGCCG
4B: TCATGGGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA
5A: TAGTGCCTGTGGCACGATCCTATCAACTAACGACTGCT
5B: AAGGAAAGGCCGGCCGTTGTTGACGCAATCATGAATTT
6A: CAGCAGCTAGTGATAGGTAACCCAGGTACTGCACCACC
6B: GGACTATACGTAGCTAGCTAACCGGTTAAGCGCGCATT
a. | Diagram the two loci, showing the locations of the repetitive DNA and the relative positions and orientations of the 12 DNA sequence reads. |
b. | If possible, indicate how many copies of the CT repeating unit reside at either locus. |
c. | Are the data compatible with the alternative hypothesis that these clones actually represent two alleles of a single locus that differ in the number of CT repeating units? |
![Check Mark](/static/check-mark.png)
Trending nowThis is a popular solution!
![Blurred answer](/static/blurred-answer.jpg)
Chapter 9 Solutions
GENETICS(LL)-W/CONNECT >CUSTOM<
- Price of visit Number of visits $700 0 $600 [1 $500 2 $400 3 $300 4 00000 The Table blow gives the demand curve for doctor visits for Elena. If the price of a doctor's visit is $600, and Elena does not have health insurance, she will visit the doctor times. If Elena obtains 50% coinsurance (the company pays 50% of the medical bill, Elena pays 50%), then Elena will visit the doctor times. 1; 2 0; 3 0; 2 1;4 2; 1arrow_forwardP 200 150- 100 50 w/instrance/ w/insurance 2 100 Demand Assume that the white curve (labeled "Demand") represents an individual's true demand for this particular health care service. The coinsurance associated with insurance option 1 (in blue) is likely _. 0000 100% 25% 50% 0%arrow_forwardUse the figure below. Bob and Nancy have the same income and total utility.. willingness to pay for an insurance premium will be lower than because they are. risk- averse. Total utility Current utility Bob's utility Nancy's utility 0000 Bob; Nancy; less Nancy; Bob; less Nancy; Bob; more Bob; Nancy; more Current Income incomearrow_forward
- Consider the figure below. Suppose the true price of a health care service is P1. Suppose further that the individual has obtained insurance that has a fixed copayment for this particular service. The copayment is represented by price P2. represents the quantity of the service the individual would consume without insurance. quantity of the service the individual would consume with the insurance. Health Care Service represents the P. P₂ a Q1;Q2 Q2; Q3 Q1; Q3 Q3; Q1 Q2; Q1 फ f Q ८ g d h Q3\D 7Q 00000arrow_forwardThe table shows the utility Jordan receives at various income levels, but they do not know what their income will be next year. There is a 15% chance their income will be $25,000, a 20% chance their income will be $35,000, and a 65% chance their income will be $45,000. We know that Jordan is Income $25,000 Utility 2,800 30,000 3,200 35,000 3,500 40,000 3,700 45,000 3,800 ☐ none of the above 0 000 risk taker (lover) because their marginal utility of income is increasing risk neutral because their marginal utility of income is constant risk averse because their marginal utility of income is decreasing risk neutral because their marginal utility of income is decreasingarrow_forwardOOOO a d+e d a+b+c Consider the figure below. Suppose the true price of a health care service is P1. Suppose further that the individual has obtained insurance that has a fixed copayment for this particular service. The copayment is represented by price P2. The social loss from moral hazard if the individual has copayment P2 is represented graphically by the area(s): Health Care Service P. a No 4 ८ e g Q2 Q3 Darrow_forward
- OOO O The table shows the utility Jordan receives at various income levels, but they do not know what their income will be next year. There is a 15% chance their income will be $25,000, a 20% chance their income will be $35,000, and a 65% chance their income will be $45,000. We know that Jordan's expected income is. Their utility from their expected income is_ Income $25,000 Utility 2,800 30,000 3,200 35,000 3,500 40,000 3,700 45,000 3,800 $45,000; 3,800 $40,000; 3,700 $25,000; 2,800 $35,000; 3,500 $30,000; 3,200arrow_forwardQuestion 1 Classify the Bird Mark 7; how is it: Powered Triggered Cycled Classify brid mark 7 Powered: By gas (oxygen) Triggered: Negative Pressure, caused by the patient’s inspiratory effort Cycled: The machine stops delivering gas and allows for exhalationarrow_forwardHypothetical "pedigree" for Sickle Cellarrow_forward
- would this be considered a novel protein and if not how can I fix it so it is and can you draw the corrections pleasearrow_forwardIn as much detail as possible, hand draw a schematic diagram of the hypothalamic-pituitary- gonad (HPG) axis in the human male. Be sure to include all the relevant structures and hormones. You must define all abbreviations the first time you use them. Please include (and explain) the feedback loops.arrow_forwardA negligence action was brought by a mother against a hospital on behalf of her minor daughter. It alleged that when the mother was 13 years of age, the hospital negligently transfused her with Rh-positive blood. The mother's Rh-negative blood was incompatible with and sensitized by the Rh-positive blood. The mother discovered her condition 8 years later during a routine blood screening ordered by her healthcare provider in the course of prenatal care. The resulting sensitization of the mother's blood allegedly caused damage to the fetus, resulting in physical defects and premature birth. Did a patient relationship with the transfusing hospital exist?arrow_forward
- Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage LearningBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxBiology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning
- Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax CollegeHuman Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage LearningCase Studies In Health Information ManagementBiologyISBN:9781337676908Author:SCHNERINGPublisher:Cengage
![Text book image](https://www.bartleby.com/isbn_cover_images/9781305389892/9781305389892_smallCoverImage.gif)
![Text book image](https://www.bartleby.com/isbn_cover_images/9781947172517/9781947172517_coverImage_Textbooks.gif)
![Text book image](https://www.bartleby.com/isbn_cover_images/9781305117396/9781305117396_smallCoverImage.gif)
![Text book image](https://www.bartleby.com/isbn_cover_images/9781938168116/9781938168116_smallCoverImage.gif)
![Text book image](https://www.bartleby.com/isbn_cover_images/9781305251052/9781305251052_smallCoverImage.gif)