Concept explainers
Introduction:
Organisms can reproduce sexually by the production of sex cells also called gametes. These cells are very different for the male and female of a species. Humans have male sex cells called spermatozoa (sperm cells). These cells are relatively motile. Female sex cells, called eggs, are non-motile. They are larger in comparison to the male gametes.

Answer to Problem 1MCQ
Correct answers:
Gametes are produced by the process of meiosis. Various genetic recombination events occur at the time of meiosis. Hence, the correct answer is option c.
Explanation of Solution
Reasons for correct answer:
Option c. is given as “the ability to generate new genetic combinations.”
Meiosis includes the process of the pairing of two homologous chromosomes. New genetic combinations are observed due to segregation and recombination mechanisms. Meiosis also plays an important role in the production of gametes in an organism. Hence, option c. is correct.
Reason for incorrect answer:
Option a. is given as, “the ability of a cell to divide.”
All cells have the ability to divide. Cell division mainly occurs by the process of mitosis and meiosis. All types of cell division may not result in the formation of new genetic combinations. Cell division ability is not restricted to sex cells only. Hence, option a. is incorrect.
Option b. is given as, “the production of offspring.”
Offspring are produced by the process of fusion of male and female gametes. The sex cells will fuse to form a zygote. The zygote will result in the formation of offspring. Hence, option b. is incorrect.
Option d. is given as, “Each of the above is unique to sexual reproduction.”
The process of meiosis produces sex cells. Only sex cells have the ability to produce genetic recombination. Each cell of the body can divide. Hence, option d. is incorrect.
Sex cells have the ability to undergo the process of meiosis and bring genetic recombination in the cell. Thus, the correct answer is option c.
Want to see more full solutions like this?
Chapter 9 Solutions
BIOLOGY:ESSENTIALS NSU (LL)-W/ACCESS
- Anwser these Discussion Questions: Part One Why were the plants kept in the dark prior to the experiment? Why is this important? Why is it important to boil the leaf? Explain why it was necessary to use boiling alcohol? What is the purpose of the iodine? Part Two What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out? What conclusions can you draw from this part of the lab? Part Three 7. In this experiment what was the purpose of adding the soda lime? 8. Why was a sealed bag placed around each plant? 9. What happened in the control plants? 10. What was the result on photosynthesis? Part Four 11. Why was a variegated leaf used in this experiment? !2. What conclusions can you draw about starch production in a variegated leaf?arrow_forwardHow did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forward
- What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forward
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
- Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax CollegeHuman Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning



