Concept explainers
Videos
The following is a portion of a protein: met-trp-tyr-arg-gly-pro-thr-Various mutant forms of this protein have been recovered. Using the normal and mutant sequences, determine the DNA and mRNA sequences that code for this portion of the protein, and explain each of the mutations.
- a. met-trp-
- b. met-cys-ile-val-val-leu-gln-
- c. met-trp-tyr-arg-ser-pro-thr-
- d. met-trp-tyr-arg-gly-ala-val-ile-ser-pro-thr-
a.
To determine: The DNA and mRNA sequences that code for this normal protein “met-trp-tyr-arg-gly-pro-thr” and explain the mutation in “met-trp”.
Introduction: The proteins are coded from triplet codons. There are 64 triplet codons, which code for 20 amino acids in which initiation and stop codons are also included. The initiation codons allow the mRNA to transcribe the DNA template while stop codons restrict the translation.
Explanation of Solution
The possible triplet codons for the normal protein “met-trp-tyr-arg-gly-pro-thr” are as follows:
| Met | Trp | Tyr | Arg | Gly | Pro | Thr |
| AUG | UGG | UAU | AGA | GGU | CCU | ACU |
| UAC | AGG | GGC | CCC | ACC | ||
| GGA | CCA | ACA | ||||
| GGG | CCG | ACG |
These are the possible triplet codons for “met-trp-tyr-arg-gly-pro-thr” protein. Any mutation in the above sequences may lead to mutation.
The first mutation occurred and formed “met-trp” protein. Possibly, the mutation occurred at ‘tyr’, which resulted in the termination. The termination is caused by a stop codon. The possible triplet codons after mutation in “met-trp” are :
| Met | Trp | Stop codons |
| AUG | UGG | UAA |
| UAG |
In the original sequence, tyrosine is present. However in mutated sequences, stop codons are formed, which shorten the polypeptide to Trp.
b.
To determine: The DNA and mRNA sequences that code for this normal protein “met-trp-tyr-arg-gly-pro-thr” and explain the mutation in “met-cys-ile-val-val-leu-gln”.
Introduction: The proteins are coded from triplet codons. There are 64 triplet codons which code for 20 amino acids in which initiation and stop codons are also included. The initiation codon allows the mRNA to transcribe the DNA template; whereas, stop codons restrict the translation.
Explanation of Solution
The possible triplet codons for the normal protein “met-trp-tyr-arg-gly-pro-thr” are as follows:
| Met | Trp | Tyr | Arg | Gly | Pro | Thr |
| AUG | UGG | UAU | AGA | GGU | CCU | ACU |
| UAC | AGG | GGC | CCC | ACC | ||
| GGA | CCA | ACA | ||||
| GGG | CCG | ACG |
These are the possible triplet codons for “met-trp-tyr-arg-gly-pro-thr” protein. Any mutation in the above sequences may lead to mutation.
The second mutation occurred and formed “met-cys-ile-val-val-leu-gln” protein. Possibly the point mutation occurred which caused changes in the reading frame. The triplet codons of the mutated protein “met-cys-ile-val-val-leu-gln” are :
| Met | Cys | Ile | Val | Val | Leu | Gln |
| AUG | UGU | AUA | GUG | GUC | CUA | ACU |
| GUG | ACC | |||||
| ACA | ||||||
| ACG |
The highlighted codons are mutated. The single place deletion or insertion may arise this type of situation where the complete sequence is changed.
c.
To determine: The DNA and mRNA sequences that code for this normal protein “met-trp-tyr-arg-gly-pro-thr” and explain the mutation in “met-trp-tyr-arg-ser-pro-thr”.
Introduction: The proteins are coded from triplet codons. There are 64 triplet codons which code for 20 amino acids in which initiation and stop codons are also included. The initiation codon allows the mRNA to transcribe the DNA template; whereas, the stop codons restrict the translation.
Explanation of Solution
The possible triplet codons for the normal protein “met-trp-tyr-arg-gly-pro-thr” are as follows:
| Met | Trp | Tyr | Arg | Gly | Pro | Thr |
| AUG | UGG | UAU | AGA | GGU | CCU | ACU |
| UAC | AGG | GGC | CCC | ACC | ||
| GGA | CCA | ACA | ||||
| GGG | CCG | ACG |
These are the possible triplet codons for “met-trp-tyr-arg-gly-pro-thr” protein. Any mutation in the above sequences may lead to mutation.
The third mutation occurred and formed “met-trp-tyr-arg-ser-pro-thr” protein. Possibly the frameshift mutation occurred, which caused changes in the reading frame. The triplet codons of the mutated protein “met-trp-tyr-arg-ser-pro-thr” are :
| Met | Trp | Tyr | Arg | Ser | Pro | Thr |
| AUG | UGG | UAU | AGA | AGU | CCU | ACU |
| UAC | AGG | CCC | ACC | |||
| CCA | ACA | |||||
| CCG | ACG |
Here, the only codon for glycine is completely changed. The single frame is inserted and deleted from the same place.
d.
To determine: The DNA and mRNA sequences that code for this normal protein “met-trp-tyr-arg-gly-pro-thr” and explain the mutation in “met-trp-tyr-arg-gly-ala-val-ile-ser-pro-thr-”.
Introduction: The proteins are coded from triplet codons. There are 64 triplet codons, which code for 20 amino acids in which initiation and stop codons are also included. The initiation codon allows the mRNA to transcribe the DNA template; whereas, the stop codons restrict the translation.
Explanation of Solution
The possible triplet codons for the normal protein “met-trp-tyr-arg-gly-pro-thr” are as follows:
| Met | Trp | Tyr | Arg | Gly | Pro | Thr |
| AUG | UGG | UAU | AGA | GGU | CCU | ACU |
| UAC | AGG | GGC | CCC | ACC | ||
| GGA | CCA | ACA | ||||
| GGG | CCG | ACG |
These are the possible triplet codons for “met-trp-tyr-arg-gly-pro-thr” protein. Any mutation in the above sequences may lead to mutation.
The second mutation occurred and formed “met-trp-tyr-arg-gly-ala-val-ile-ser-pro-thr-” this protein. This is a type of mutation where the reading frame is shifted because this protein is relatively larger than the normal protein.
Hence, frame insertion is a possible way due to which the protein is completely changed.
Want to see more full solutions like this?
Chapter 9 Solutions
Human Heredity: Principles and Issues
- The normal sequence of a protein is: Met – Thr – Lys – His – Ser – Ser ... Mutations of the DNA have led to the following protein sequences. In each case, provide a specific explanation of the mutation or mutations that could have occurred. a. Met – Pro – Lys – His – Ser – Ser ... b. Met – Thr c. Met – Thr – Lys – Gln – Leu – Phe ...arrow_forwardGive only typing answer with explanation and conclusionarrow_forwardA. What amino acid sequence is encoded by the codon sequence AUAAUGGUAACGGUU? B. Suppose the codon sequence AGACACUCUAUUAAA has a single base pair mutation to AGACACUCUUUUAAA. If the old protein sequence was Arg-His-Ser-Ile-Lys, what will be the new sequence encoded by the mutant gene?arrow_forward
- I only need letter D and Earrow_forwardA fragment of a polypeptide, Met-Thr-Ile-Ser-Asp-Ile is encoded by the following sequence of DNA:Strand A - TACGATGACGATAAGCGACATAGC - Strand B - ATGCTACTGCTATTCGCTGTATCG -Which is the transcribed (template) strand? Write the sequence of the resulting mRNA transcript. Add labels to the strands above to show the 3’ and 5’ ends.arrow_forwardWhat is the correct amino acid sequence for the mRNA code AUGCCAGUAUGA answer choices A. Tyr-Gly-His B. Met-Pro-Val C. Met-Pro-Ala-Val D. Tyr-Gly-Arg-Hisarrow_forward
- Sickle cell anemia is caused by a point mutation in the β-globin chain of hemoglobin. Glutamic acid is replaced by Valine. HBB sequence in normal adult hemoglobin (Hb A): Leu-Thr-Pro-Glu-Glu-Lys-Ser HBB sequence in mutant adult hemoglobin (Hb S): Leu-Thr-Pro-Val-Glu-Lys-Ser What effect does this mutation have on the structure and function of the protein? Predict what would happen to the RBC if the glutamic acid was replaced with asparagine instead of valine.arrow_forwardCompare the two DNA sequences shown below and consider the single nucleotide mutation made In the lower DNA sequence (shown in bold font). This is an example of a mutation. DNA: АTG CGC TСС САТ СТТ ААС AAА GAG GTT GGC ТАТ ТТТ Protein: Met-Arg-Ser-His-Leu-Asn-Lys-Glu-Ala-Gly-Tyr-Phe DNA: ATG CGC TCC CAT CTT AAC CAA AGA GGT TGG CTA TTT T Protein: Met-Arg-Ser-His-Leu-Asn-Gln-Arg-Gly-Trp-Leu-Phe- missense nonsense antisense O frame-shift silentarrow_forwardThe template strand of a segment of double-helical DNA contains the sequence – 5’-CTT-AAC-ACC-CCT-GAC-TTC-GCG-CCG-CAT-3’ a. What is the base sequence of the complementary strand of DNA? Indicate the 5’ and the 3’ ends. b. What is the base sequence of the mRNA that can be transcribed from this template DNA strand? Indicate the 5’ and the 3’ ends. c. What amino acid sequence can be coded by the mRNA in (b) starting from the 5’ end (or the N terminal amino acid)?arrow_forward
- Consider the now dominant variant of the SARS-CoV-2 called the D614G mutation: a) The mutation changes an Aspartate (D, Asp) to a Glycine (G, Gly) at nucleotide position 614 (that’s why it’s called the D614G mutant) in the S1 subunit of the Spike protein. Using only the information above and a codon table, what are the mRNA codon sequences of the 2019-dominant and 2020-dominant Spike proteins? Note the figure above is not needed toanswer the question. Report in 5’ to 3' orientation __________________________________________ b) What type of substitution is this? In your answer, address the following: • The expected substitution in base sequence (e.g., A à C)• If the mutation is synonymous, nonsynonymous, or a frameshift• If the mutation is a transition or a transversion c) The mutation increases infectivity by reducing the stability of the Spike protein such that it can remain in the open conformation more often. The open conformation increases the chances of binding to the host ACE2…arrow_forwardA particular protein has the amino acid sequenceN . . . Ala-Pro-His-Trp-Arg-Lys-Gly-Val-Thr . . . Cwithin its primary structure. A geneticist studyingmutations affecting this protein discovered that several of the mutants produced shortened protein molecules that terminated within this region. In one ofthem, the His became the terminal amino acid.a. What DNA single-base change(s) would cause theprotein to terminate at the His residue?b. What other potential sites do you see in the DNAsequence encoding this protein where mutation ofa single base pair would cause premature termination of translation?arrow_forwarda. Identify the type of mutation shown below. b. How many amino acids are affected? c. What type of impact will this mutation have on the functionality of the protein? Second Letter UAU Tyr UAC UUU UCU UGU UGC Phe Cys C UUC UUA UUG UCC UCA Ser UAA Stop UGA Stop A UAG Stop UGG Trp G Leu UCG CGU CAU His CCU C CCA G CUU CUC CAC CGC Leu CUA Arg Pro CGA CGG CAA Gin CUG CAG AUU AUC lle AUA AUG Met ACG ACU ACC ACA AAU Asn AAC The AAA AGU AGC Ser AGA AAG Lya AGG Arg GCU GCC GUU GAU GAC GAA GAG GGU GGC Gly Asp GUC Val GUA Ala GCA GCG GGA Glu GGG GUG ACC T C A G. G. 6. G G A C T. T. G. Original DNA strand G T A G. G. T. G. G. GA CT T. G. Mutated DNA strand First letter Third letterarrow_forward
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
Biology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning