Bundle: Biology: The Unity and Diversity of Life, 14th + LMS Integrated for MindTap Biology, 1 term (6 months) Printed Access Card
14th Edition
ISBN: 9781305774384
Author: Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr
Publisher: Cengage Learning
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 8, Problem 1CT
Summary Introduction
To determine: The complementary strand of DNA that forms on the given template DNA fragment during replication.
Concept introduction: Replication of DNA is the process by which DNA duplicates to form two daughter DNA strands, which are identical to the mother strand.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Write the complementary strand to the following single-stranded DNA and label the 5' and 3' ends: 5'-ATAGCATGGGCCATACGATTACTGA-3'
Complete the complementary stand of the DNA shown
Complementary strand
стАG GTACT CAC G
Show the replication strands in each of these bubbles (note they have
different DNA orientations). Label each end of each DNA strand and include arrows to
show which direction it is extending. Show the Okazaki fragments in the correct places.
3'
5'
Chapter 8 Solutions
Bundle: Biology: The Unity and Diversity of Life, 14th + LMS Integrated for MindTap Biology, 1 term (6 months) Printed Access Card
Ch. 8 - Which is not a nucleotide base in DNA? a. adenine...Ch. 8 - What are the base-pairing rules for DNA? a. A-G,...Ch. 8 - Variation in _____ is the basis of variation in...Ch. 8 - One species' DNA differs from others in its...Ch. 8 - Prob. 5SQCh. 8 - Prob. 6SQCh. 8 - Prob. 7SQCh. 8 - When DNA replication begins, ______. a. the two...Ch. 8 - DNA replication requires _______. a. DNA...Ch. 8 - HersheyChase Experiments The graph shown in FIGURE...
Ch. 8 - HersheyChase Experiments The graph shown in FIGURE...Ch. 8 - HersheyChase Experiments The graph shown in FIGURE...Ch. 8 - HersheyChase Experiments The graph shown in FIGURE...Ch. 8 - HersheyChase Experiments The graph shown in FIGURE...Ch. 8 - Energy that drives the attachment of a nucleotide...Ch. 8 - The phrase "5 prime to 3 prime" refers to the...Ch. 8 - After DNA replication, a eukaryotic chromosome...Ch. 8 - Prob. 13SQCh. 8 - Prob. 14SQCh. 8 - Prob. 15SQCh. 8 - Prob. 1CTCh. 8 - Woolly mammoths have been extinct for about 4,000...Ch. 8 - Xeroderma pigmentosum is an inherited disorder...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Using Figures 8.7 and 8.9 as a guide, draw a dinucleotide composed of C and A. Next to this, draw the complementary dinucleotide in an antiparallel fashion. Connect the dinucleotides with the appropriate hydrogen bonds. FIGURE 8.9 The two polynucleotide chains in DNA run in opposite directions. The left strand runs 5 to 3, and the right strand runs 3 to 5. The base sequences in each strand are complementary. An A in one strand pairs with a T in the other strand, and a C in one strand is paired with a G in the opposite strand. FIGURE 8.7 Nucleotides can be joined together to form chains caled polynucleotides. Polynucleotides are polar molecules with a 5 end (at the phosphate group) and a 3 end (at the sugar group). An RNA polynucleotide is shown at the left, and a DNA polynucleotide is shown at the right.arrow_forwardMake the complementary strand for the following DNA template and label both strands as 5 to 3 or 3 to 5 (P = phosphate in the diagram). Draw an arrow showing the direction of synthesis of the new strand. How many hydrogen bonds are in this double strand of DNA? template: PAGGCTCGOH new strand:arrow_forwardCreate the complimentary strand for the DNA strand below. Make sure to label the parts and direction of the strand. 5’-GGCAACGGTCCAGTCCAAGTTACG-3’arrow_forward
- This is part of the Escherichia coli DNA sequence that contains an inverted repeat. (Note: top strand is the coding strand). 5'-AACGCATGAGAAAGCCCCCCGGAAGATCACCTTCCGGGGGCTTTATATAATTAGC-3' 3'-TTGCGTACTCTTTCGGGGGGCCTTCTAGTGGAAGGCCCCCGAAATATATTAATCG-5' (i) Draw the structure of hairpin loop that will be formed during the end of transcription. (ii) Describe the function of the hairpin loop during transcription.arrow_forwardBelow is a depiction of a replication bubble. 5' AGCTCCGATCGCGTAACTTT 3' TCGAGGCTAGCGCATTGAAA CTAAAGCTTCGGGCATTATCG 3' GATTTCGAAGCCCGTAATAGC TATCGACS Consider the following primer which binds to the DNA replication bubble on the diagram above: 5'-GCUAUCG-3' Identify the DNA sequence to which this primer would bind and the orientation. If the replication fork moves to the right, will the primer be used to create the leading strand of replication or the lagging strand? Explain your answer b. If the replication fork moves to the left, will the primer be used to create the leading strand of replication or a. the lagging strand? Explain your answer. What would the next five nucleotides added to the primer by DNA polymerase? С.arrow_forwardDetermine the complementary strand of DNA that forms on this template DNA fragment during replication: 5′GGTTTCTTCAAGAGA3′arrow_forward
- Fill in the palindromic sequence of the given DNA strand containing six bases. 5' GACGTC 3' 3' _ _ _ _ _ 5'arrow_forwardComplete the complementary strand: DNA replication ATTCGAGGCTAAarrow_forwardDNA is made of two strands that are antiparallel. If one strand runs from 3’ to 5’ direction the other one will go from 5’ to 3’ direction. During replication or transcription, whatever the process is, it will always follow the 5’ to 3’ direction using the 3’ to 5’ directed strand as the template strand. Therefore, if following is the DNA sequence 5’-CCG ATC GCA CAA-3’ Using this sequence as template after transcription no protein can be translated. Why? Presence of start codon Absence of start codon Due to mutation If you want to start the translation, what change you need in the second codon (from 5’ to 3’ direction)? Substitution of C with G No change4 Deletion of Both I & IIIarrow_forward
- Complementary strand for A T C and Garrow_forwardIndicate the proteins involved in the following steps of DNA replication in E. coli a. ___________ initiator of replication by binding to the origin of replication of the prokaryote ___________ a dimer that unzips the DNA helix ___________ an enzyme responsible for relieving positive supercoils ahead of replication fork ___________ maintains DNA in single-stranded state ___________ primary replicating enzyme ___________ synthesizes RNA primers The resulting gap by removal of RNA primer is filled in by ___________. h. the resulting nick is sealed by _____________.arrow_forwardThis is the non-template strand of a double stranded DNA. RNA is transcribed from using one of the strand (which one?) . Show the RNA sequence from 5’ to 3’ direction. Then translate the RNA sequence into protein sequence using the genetic code table. 5’AGGGTCCAC 3’arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- BiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage LearningBiology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage LearningHuman Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY