
Biology: Concepts and Investigations
3rd Edition
ISBN: 9780073525549
Author: Mariëlle Hoefnagels Dr.
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 7, Problem 27WIO
a.
Summary Introduction
To identify: The codon changes in the amino acids; a. tryptophan to Arginine, b. Glycine to valine, c. tyrosine to histidine.
Concept introduction:
A genetic code is a set of rule in which a cell uses the nucleotides in mRNA to assemble amino acids into protein. The codon consists of a group of mRNA bases corresponds to either amino acid or act as a stop codon. There are 64 codons that are used to specify the 20 amino acids.
b.
Summary Introduction
To write: The genetic code to identify the changes in the amino acid sequence from glycine to valine.
c.
Summary Introduction
To write: The genetic code to identify the changes in the amino acid sequence from tyrosine to Histidine.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanks
Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?
What is amplification bias?
Chapter 7 Solutions
Biology: Concepts and Investigations
Ch. 7.1 - How did Griffiths research, coupled with the work...Ch. 7.1 - How did the Hershey-Chase blender experiments...Ch. 7.2 - What are the components of DNA and its...Ch. 7.2 - What evidence enabled Watson and Crick to decipher...Ch. 7.2 - Prob. 3MCCh. 7.3 - What is the relationship between a gene and a...Ch. 7.3 - Prob. 2MCCh. 7.3 - What are the three types of RNA, and how does each...Ch. 7.4 - What happens during each stage of transcription?Ch. 7.4 - Where in the cell does transcription occur?
Ch. 7.4 - What is the role of RNA polymerase in...Ch. 7.4 - What are the roles of the promoter and terminator...Ch. 7.4 - How is mRNA modified before it leaves the nucleus...Ch. 7.5 - How did researchers determine that the genetic...Ch. 7.5 - What happens in each stage of translation?Ch. 7.5 - Where in the cell does translation occur?Ch. 7.5 - How are polypeptides modified after translation?Ch. 7.6 - What are some reasons that cells regulate gene...Ch. 7.6 - Prob. 2MCCh. 7.6 - Prob. 3MCCh. 7.6 - Prob. 4MCCh. 7.7 - What is a mutation?Ch. 7.7 - What are the types of mutations, and how does each...Ch. 7.7 - Prob. 3MCCh. 7.7 - Prob. 4MCCh. 7.7 - How are mutations important?Ch. 7.8 - What question about the FOXP2 gene were the...Ch. 7.8 - What insights could scientists gain by...Ch. 7 - A nucleotide is composed of all of the following...Ch. 7 - Prob. 2MCQCh. 7 - Transcription copies a _______ to a complementary...Ch. 7 - Choose the DNA sequence from which this mRNA...Ch. 7 - Prob. 5MCQCh. 7 - Prob. 6MCQCh. 7 - Prob. 7MCQCh. 7 - How does the lac operon regulate lactose digestion...Ch. 7 - Prob. 9MCQCh. 7 - Prob. 10MCQCh. 7 - Explain how Griffiths experiment and Avery,...Ch. 7 - Prob. 2WIOCh. 7 - Prob. 3WIOCh. 7 - Prob. 4WIOCh. 7 - Put the following in order from smallest to...Ch. 7 - Prob. 6WIOCh. 7 - Prob. 7WIOCh. 7 - Prob. 8WIOCh. 7 - List the three major types of RNA and their...Ch. 7 - Some people compare DNA to a blueprint stored in...Ch. 7 - Prob. 11WIOCh. 7 - Prob. 12WIOCh. 7 - Refer to the figure to answer these questions: a....Ch. 7 - Prob. 14WIOCh. 7 - Prob. 15WIOCh. 7 - If a protein is 1259 amino acids long, what is the...Ch. 7 - Prob. 17WIOCh. 7 - The roundworm C. elegans has 556 cells when it...Ch. 7 - Prob. 19WIOCh. 7 - Prob. 20WIOCh. 7 - Prob. 21WIOCh. 7 - A protein-encoding region of a gene has the...Ch. 7 - Explain how a mutation in a protein-encoding gene,...Ch. 7 - Prob. 24WIOCh. 7 - Describe the mutation shown in figure 7.27 and...Ch. 7 - Prob. 26WIOCh. 7 - Prob. 27WIOCh. 7 - Prob. 28WIOCh. 7 - Prob. 29WIOCh. 7 - Refer to figure 7.28 and the chapter con tent to...Ch. 7 - Prob. 2PITCh. 7 - Prob. 3PITCh. 7 - Prob. 4PIT
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
- Biology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forwardBiology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education

Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON

Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax

Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,

Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company

Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.

Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Macromolecules | Classes and Functions; Author: 2 Minute Classroom;https://www.youtube.com/watch?v=V5hhrDFo8Vk;License: Standard youtube license