
Concept explainers
Introduction:
Autotrophs are the organisms that make their own food by using sunlight, carbon dioxide and water by the process of photosynthesis. Photosynthesis is the process by which autotrophic organisms use sunlight energy to make sugar and oxygen gas from carbon dioxide and water.

Answer to Problem 1U
Correct answer:
Autotrophs are the organisms that produce their own food by the process of the photosynthesis. Therefore, option d. is correct.
Explanation of Solution
Reason for correct answer:
Photosynthesis is the process in which the light energy is converted into the chemical energy. Autotrophs are those organisms that produce their own food by the help of the photosynthesis process.
Option d. is given as “does both a and b”.
As, “autotrophs are the organisms that are able to convert the light energy into the chemical energy and harness energy from organic sources,” is the right answer.
Hence, option d. is correct.
Reason for the incorrect statements:
Option a. is given as “extracts energy from organic sources”.
Autotrophs extracts energy from organic sources. It is not the only process being performed by the autotrophs. So, it is a wrong answer.
Option b. is given as “converts energy from sunlight into chemical energy”.
Autotrophs produce their own energy from the process of photosynthesis. It is not the only process being performed by the autotrophs. So, it is a wrong answer.
Option c. is given as “relies on the energy produced by other organisms as an energy source”.
Autotroph produces their own good by using energy from sunlight and does not rely on other organisms for energy requirements. So, it is a wrong answer.
Hence, options a, b, and c are incorrect.
Autotrophs are the self-nourishing organisms such as green plants. Autotrophs use photosynthesis process to harness energy from the sunlight to produce oxygen and sugar molecules.
Want to see more full solutions like this?
Chapter 7 Solutions
Biology
- series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forward
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage LearningConcepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax CollegeComprehensive Medical Assisting: Administrative a...NursingISBN:9781305964792Author:Wilburta Q. Lindh, Carol D. Tamparo, Barbara M. Dahl, Julie Morris, Cindy CorreaPublisher:Cengage Learning
- Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning




