
Lab Manual for Biology
12th Edition
ISBN: 9781259298516
Author: Sylvia S. Mader Dr.
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 7, Problem 1TS
Summary Introduction
To explain:
The reason, when algae exposed to different color wavelengths of light then why bacteria are clustered at the ends of algae.
Introduction:
The unit of light is frequency or wavelength. The light range of 430-770 nanometer(nm) can be detected by the human eye and these lights are known as visible light. The VIBGYOR spectrum of light falls in this range of visible light wavelength. The algae contains photosystem complex, which is present in the thylakoid membrane. The chloroplast absorbs 430-770 nanometer(nm) spectrum of light that helps in driving the photosynthesis.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?
Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanks
Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?
Chapter 7 Solutions
Lab Manual for Biology
Ch. 7.1 - Describe three major groups of photosynthetic...Ch. 7.1 - Prob. 2CYPCh. 7.2 - Explain how redox reactions are used in...Ch. 7.2 - Prob. 2CYPCh. 7.3 - Prob. 1CYPCh. 7.3 - Prob. 2CYPCh. 7.4 - Describe the three major steps of the Calvin...Ch. 7.4 - Prob. 2CYPCh. 7.5 - Prob. 1CYPCh. 7.5 - 2. Explain why C4 photosynthesis is advantageous...
Ch. 7 - Prob. 1BS.1QCCh. 7 - Prob. 1BS.2QCCh. 7 - Prob. 1ACh. 7 - Prob. 2ACh. 7 - Prob. 3ACh. 7 - Prob. 4ACh. 7 - Prob. 5ACh. 7 - Prob. 6ACh. 7 - Prob. 7ACh. 7 - RuBP carboxylase is the enzyme that fixes carbon...Ch. 7 - Prob. 9ACh. 7 - Prob. 10ACh. 7 - Prob. 11ACh. 7 - Prob. 12ACh. 7 - Prob. 13ACh. 7 - Prob. 1TSCh. 7 - Prob. 2TS
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
- Biology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forwardBiology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forwardBiology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education

Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON

Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax

Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,

Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company

Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.

Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Endosymbiotic Theory; Author: Amoeba Sisters;https://www.youtube.com/watch?v=FGnS-Xk0ZqU;License: Standard Youtube License