
Concept explainers
The following is a list of mutational changes. For each of the specific mutations described, indicate which of the terms in the right-hand column applies, either as a description of the mutation or as a possible cause. More than one term from the right column can apply to each statement in the left column.
1. an A-T base pair in the wild-type gene is changed to a G-C pair | a. transition |
2. an A-T base pair is changed to a T-A pair | b. base substitution |
3. the sequence AAGCTTATCG is changed to AAGCTATCG | c. transversion |
4. the sequence CAGCAGCAGCAGCAGCAG is changed to CAGCAGCAGCAGCAGCAGCAG | d. deletion |
5. the sequence AACGTTATCG is changed to AATGTTATCG | e. insertion |
6. the sequence AACGTCACACACATCG is changed to AACGTCACATCG | f. deamination |
7. the sequence AAGCTTATCG is changed to AAGCTTTATCG | g. X-ray irradiation |
h. intercalator | |
i. slipped mispairing |

1.
To determine:
The item that describes “an A-T base pair in the wild-type gene is changed to a G-C pair.”
1. an A-T base pair in the wild-type gene is changed to a G-C pair.
2. an A-T base pair is changed to a T-A pair.
3. the sequence AAGCTTATCG is changed to AAGCTATCG.
4. the sequence CAGCAGCAGCAGCAGCAG is changed to CAGCAGCAGCAGCAGCAGCAG.
5. the sequence AACGTTATCG is changed to AATGTTATCG.
6. the sequence AACGTCACACACATCG is changed to AACGTCACATCG.
7. the sequence AAGCTTATCG is changed to AAGCTTTATCG.
Introduction:
When purines and pyrimidines are exchanged with each other, the process is called transition.
Answer to Problem 1P
Correct answer:
An A-T base pair in the wild-type gene is changed to a G-C pair: transition and base substitution.
Explanation of Solution
In the given mutation, A-T base pair is exchanged with a G-C base pair so it can be a base substitution. This can also be a transition mutation because adenine is a purine which is interchanged with another purine that is guanine. Thymine replaced the cytosine, and both are also pyrimidines. Thus, this condition can be a base substitution mutation or a transition mutation.

2.
To determine:
The item that describes “an A-T base pair is changed to a T-A pair”.
1. an A-T base pair in the wild-type gene is changed to a G-C pair.
2. an A-T base pair is changed to a T-A pair.
3. the sequence AAGCTTATCG is changed to AAGCTATCG.
4. the sequence CAGCAGCAGCAGCAGCAG is changed to CAGCAGCAGCAGCAGCAGCAG.
5. the sequence AACGTTATCG is changed to AATGTTATCG.
6. the sequence AACGTCACACACATCG is changed to AACGTCACATCG.
7. the sequence AAGCTTATCG is changed to AAGCTTTATCG.
Introduction:
When one purine is replaced by pyrimidine in a pair of two bases, the resulting process is called transversion.
Answer to Problem 1P
Correct answer:
an A-T base pair is changed to a T-A pair: base substitution and transversion.
Explanation of Solution
In the given mutation, a base pair ‘A-T’ can be changed to a ‘T-A’ base-pair so the replacement of one purine with pyrimidine can be observed. Thus, the mutation for concerting A-T into T-A can be a transversion. The substitution of A by T is taking place so, it can also be a base substitution mutation.

3.
To determine:
The item that describes “the sequence AAGCTTATCG is changed to AAGCTATCG”.
1. an A-T base pair in the wild-type gene is changed to a G-C pair.
2. an A-T base pair is changed to a T-A pair.
3. the sequence AAGCTTATCG is changed to AAGCTATCG.
4. the sequence CAGCAGCAGCAGCAGCAG is changed to CAGCAGCAGCAGCAGCAGCAG.
5. the sequence AACGTTATCG is changed to AATGTTATCG.
6. the sequence AACGTCACACACATCG is changed to AACGTCACATCG.
7. the sequence AAGCTTATCG is changed to AAGCTTTATCG.
Introduction:
In this particular case, the exposure of X-rays is responsible for deletion mutation from the wild type sequence.
Answer to Problem 1P
Correct answer:
the sequence AAGCTTATCG is changed to AAGCTATCG: deletion and X-ray irradiation.
Explanation of Solution
If both, wild type and mutated sequence are observed that it can be seen that there is a deletion of nitrogenous base T from wild type sequence. The exposure to X-ray irradiation may be responsible for deletion mutation. Thus, the correct match for the given mutation is deletion and X-ray irradiation.

4.
To determine:
The item that describes “the sequence CAGCAGCAGCAGCAGCAG is changed to CAGCAGCAGCAGCAGCAGCAG”.
1. an A-T base pair in the wild-type gene is changed to a G-C pair.
2. an A-T base pair is changed to a T-A pair.
3. the sequence AAGCTTATCG is changed to AAGCTATCG.
4. the sequence CAGCAGCAGCAGCAGCAG is changed to CAGCAGCAGCAGCAGCAGCAG.
5. the sequence AACGTTATCG is changed to AATGTTATCG.
6. the sequence AACGTCACACACATCG is changed to AACGTCACATCG.
7. the sequence AAGCTTATCG is changed to AAGCTTTATCG.
Introduction:
When one or more nitrogenous bases are added to a specific sequence of nucleotides, then the process of insertion takes place.
Answer to Problem 1P
Correct answer:
The sequence CAGCAGCAGCAGCAGCAG is changed to CAGCAGCAGCAGCAGCAGCAG: insertion and intercalator.
Explanation of Solution
Insertion is a mutation in which a nitrogenous base or a group of the nitrogenous bases are added to a sequence. In the given mutation, a thymine residue is added to the wild type sequence for mutation. Thus, the kind of mutation is an insertion, and it can result from the introduction of some chemical mutagens like ethidium bromide. These chemical mutagens are intercalated with sequence and are known as intercalators. Thus, the correct match for the given mutation is insertion and intercalator.

5.
To determine:
The item that describes “the sequence AACGTTATCG is changed to AATGTTATCG”.
1. an A-T base pair in the wild-type gene is changed to a G-C pair.
2. an A-T base pair is changed to a T-A pair.
3. the sequence AAGCTTATCG is changed to AAGCTATCG.
4. the sequence CAGCAGCAGCAGCAGCAG is changed to CAGCAGCAGCAGCAGCAGCAG.
5. the sequence AACGTTATCG is changed to AATGTTATCG.
6. the sequence AACGTCACACACATCG is changed to AACGTCACATCG.
7. the sequence AAGCTTATCG is changed to AAGCTTTATCG.
Introduction:
Transition is the change of one purine to another purine or one pyrimidine to another pyrimidine.
Answer to Problem 1P
Correct answer:
the sequence AACGTTATCG is changed to AATGTTATCG: base substitution, transition, and deamination.
Explanation of Solution
In the given mutation, base T is exchanged with base C so it can be a base substitution. This can also be a transition mutation because cytosine is a pyrimidine which is interchanged with another pyrimidine that is thymine. Deamination can also be noticed in the given mutation because the conversion of a methylated C to T is taking place. Thus, the correct match for the given mutation is a substitution, transition, and deamination.

6.
To determine:
The item that describes “the sequence AACGTCACACACATCG is changed to AACGTCACATCG”.
1. an A-T base pair in the wild-type gene is changed to a G-C pair.
2. an A-T base pair is changed to a T-A pair.
3. the sequence AAGCTTATCG is changed to AAGCTATCG.
4. the sequence CAGCAGCAGCAGCAGCAG is changed to CAGCAGCAGCAGCAGCAGCAG.
5. the sequence AACGTTATCG is changed to AATGTTATCG.
6. the sequence AACGTCACACACATCG is changed to AACGTCACATCG.
7. the sequence AAGCTTATCG is changed to AAGCTTTATCG.
Introduction:
Crossing over is the process of exchange of genetic material between the sister chromatids at chiasmata.
Answer to Problem 1P
Correct answer:
The sequence AACGTCACACACATCG is changed to AACGTCACATCG: deletion and crossing over.
Explanation of Solution
In the given mutation, it can be noticed that a segment CACACACA has been lost from wild type sequence, so it is representing deletion. A segment can be removed from the wild type gene during the process of crossing over. Thus, the correct match for the given mutation is deletion and crossing over.

7.
To determine:
The item that describes “the sequence AAGCTTATCG is changed to AAGCTTTATCG”.
1. an A-T base pair in the wild-type gene is changed to a G-C pair.
2. an A-T base pair is changed to a T-A pair.
3. the sequence AAGCTTATCG is changed to AAGCTATCG.
4. the sequence CAGCAGCAGCAGCAGCAG is changed to CAGCAGCAGCAGCAGCAGCAG.
5. the sequence AACGTTATCG is changed to AATGTTATCG.
6. the sequence AACGTCACACACATCG is changed to AACGTCACATCG.
7. the sequence AAGCTTATCG is changed to AAGCTTTATCG.
Introduction:
When one or more nitrogenous bases are removed from the nucleotide sequence, then the process is called deletion.
Answer to Problem 1P
Correct answer:
the sequence AAGCTTATCG is changed to AAGCTTTATCG: deletion and X-ray irradiation.
Explanation of Solution
Observation of wild type and mutated sequence can lead to a conclusion that there is a deletion of nitrogenous base T from wild type sequence. Deletion mutation may happen to because of exposure to X-ray irradiation. Thus, the correct match for the given mutation is deletion and X-ray irradiation.
Want to see more full solutions like this?
Chapter 7 Solutions
EBK GENETICS: FROM GENES TO GENOMES
Additional Science Textbook Solutions
Campbell Essential Biology (7th Edition)
Organic Chemistry
Microbiology Fundamentals: A Clinical Approach
Human Physiology: An Integrated Approach (8th Edition)
Laboratory Manual For Human Anatomy & Physiology
- Ch.21 What causes patients infected with the yellow fever virus to turn yellow (jaundice)? A. low blood pressure and anemia B. excess leukocytes C. alteration of skin pigments D. liver damage in final stage of disease — What is the advantage for malarial parasites to grow and replicate in red blood cells? A. able to spread quickly B. able to avoid immune detection C. low oxygen environment for growth D. cooler area of the body for growth — Which microbe does not live part of its lifecycle outside humans? A. Toxoplasma gondii B. Cytomegalovirus C. Francisella tularensis D. Plasmodium falciparum — explain your answer thoroughlyarrow_forwardCh.22 Streptococcus pneumoniae has a capsule to protect it from killing by alveolar macrophages, which kill bacteria by… A. cytokines B. antibodies C. complement D. phagocytosis — What fact about the influenza virus allows the dramatic antigenic shift that generates novel strains? A. very large size B. enveloped C. segmented genome D. over 100 genes — explain your answer thoroughlyarrow_forwardWhat is this?arrow_forward
- Molecular Biology A-C components of the question are corresponding to attached image labeled 1. D component of the question is corresponding to attached image labeled 2. For a eukaryotic mRNA, the sequences is as follows where AUGrepresents the start codon, the yellow is the Kozak sequence and (XXX) just represents any codonfor an amino acid (no stop codons here). G-cap and polyA tail are not shown A. How long is the peptide produced?B. What is the function (a sentence) of the UAA highlighted in blue?C. If the sequence highlighted in blue were changed from UAA to UAG, how would that affecttranslation? D. (1) The sequence highlighted in yellow above is moved to a new position indicated below. Howwould that affect translation? (2) How long would be the protein produced from this new mRNA? Thank youarrow_forwardMolecular Biology Question Explain why the cell doesn’t need 61 tRNAs (one for each codon). Please help. Thank youarrow_forwardMolecular Biology You discover a disease causing mutation (indicated by the arrow) that alters splicing of its mRNA. This mutation (a base substitution in the splicing sequence) eliminates a 3’ splice site resulting in the inclusion of the second intron (I2) in the final mRNA. We are going to pretend that this intron is short having only 15 nucleotides (most introns are much longer so this is just to make things simple) with the following sequence shown below in bold. The ( ) indicate the reading frames in the exons; the included intron 2 sequences are in bold. A. Would you expected this change to be harmful? ExplainB. If you were to do gene therapy to fix this problem, briefly explain what type of gene therapy youwould use to correct this. Please help. Thank youarrow_forward
- Molecular Biology Question Please help. Thank you Explain what is meant by the term “defective virus.” Explain how a defective virus is able to replicate.arrow_forwardMolecular Biology Explain why changing the codon GGG to GGA should not be harmful. Please help . Thank youarrow_forwardStage Percent Time in Hours Interphase .60 14.4 Prophase .20 4.8 Metaphase .10 2.4 Anaphase .06 1.44 Telophase .03 .72 Cytukinesis .01 .24 Can you summarize the results in the chart and explain which phases are faster and why the slower ones are slow?arrow_forward
- Can you circle a cell in the different stages of mitosis? 1.prophase 2.metaphase 3.anaphase 4.telophase 5.cytokinesisarrow_forwardWhich microbe does not live part of its lifecycle outside humans? A. Toxoplasma gondii B. Cytomegalovirus C. Francisella tularensis D. Plasmodium falciparum explain your answer thoroughly.arrow_forwardSelect all of the following that the ablation (knockout) or ectopoic expression (gain of function) of Hox can contribute to. Another set of wings in the fruit fly, duplication of fingernails, ectopic ears in mice, excess feathers in duck/quail chimeras, and homeosis of segment 2 to jaw in Hox2a mutantsarrow_forward
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage LearningBiology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage LearningBiology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning
- Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxHuman Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage LearningBiology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning





