Concept explainers
Videos
The following is a list of mutational changes. For each of the specific mutations described, indicate which of the terms in the right-hand column applies, either as a description of the mutation or as a possible cause. More than one term from the right column can apply to each statement in the left column.
| 1. an A-T base pair in the wild-type gene is changed to a G-C pair | a. transition |
| 2. an A-T base pair is changed to a T-A pair | b. base substitution |
| 3. the sequence AAGCTTATCG is changed to AAGCTATCG | c. transversion |
| 4. the sequence CAGCAGCAGCAGCAGCAG is changed to CAGCAGCAGCAGCAGCAGCAG | d. deletion |
| 5. the sequence AACGTTATCG is changed to AATGTTATCG | e. insertion |
| 6. the sequence AACGTCACACACATCG is changed to AACGTCACATCG | f. deamination |
| 7. the sequence AAGCTTATCG is changed to AAGCTTTATCG | g. X-ray irradiation |
| h. intercalator | |
| i. slipped mispairing |
1.
To determine:
The item that describes “an A-T base pair in the wild-type gene is changed to a G-C pair.”
1. an A-T base pair in the wild-type gene is changed to a G-C pair.
2. an A-T base pair is changed to a T-A pair.
3. the sequence AAGCTTATCG is changed to AAGCTATCG.
4. the sequence CAGCAGCAGCAGCAGCAG is changed to CAGCAGCAGCAGCAGCAGCAG.
5. the sequence AACGTTATCG is changed to AATGTTATCG.
6. the sequence AACGTCACACACATCG is changed to AACGTCACATCG.
7. the sequence AAGCTTATCG is changed to AAGCTTTATCG.
Introduction:
When purines and pyrimidines are exchanged with each other, the process is called transition.
Answer to Problem 1P
Correct answer:
An A-T base pair in the wild-type gene is changed to a G-C pair: transition and base substitution.
Explanation of Solution
In the given mutation, A-T base pair is exchanged with a G-C base pair so it can be a base substitution. This can also be a transition mutation because adenine is a purine which is interchanged with another purine that is guanine. Thymine replaced the cytosine, and both are also pyrimidines. Thus, this condition can be a base substitution mutation or a transition mutation.
2.
To determine:
The item that describes “an A-T base pair is changed to a T-A pair”.
1. an A-T base pair in the wild-type gene is changed to a G-C pair.
2. an A-T base pair is changed to a T-A pair.
3. the sequence AAGCTTATCG is changed to AAGCTATCG.
4. the sequence CAGCAGCAGCAGCAGCAG is changed to CAGCAGCAGCAGCAGCAGCAG.
5. the sequence AACGTTATCG is changed to AATGTTATCG.
6. the sequence AACGTCACACACATCG is changed to AACGTCACATCG.
7. the sequence AAGCTTATCG is changed to AAGCTTTATCG.
Introduction:
When one purine is replaced by pyrimidine in a pair of two bases, the resulting process is called transversion.
Answer to Problem 1P
Correct answer:
an A-T base pair is changed to a T-A pair: base substitution and transversion.
Explanation of Solution
In the given mutation, a base pair ‘A-T’ can be changed to a ‘T-A’ base-pair so the replacement of one purine with pyrimidine can be observed. Thus, the mutation for concerting A-T into T-A can be a transversion. The substitution of A by T is taking place so, it can also be a base substitution mutation.
3.
To determine:
The item that describes “the sequence AAGCTTATCG is changed to AAGCTATCG”.
1. an A-T base pair in the wild-type gene is changed to a G-C pair.
2. an A-T base pair is changed to a T-A pair.
3. the sequence AAGCTTATCG is changed to AAGCTATCG.
4. the sequence CAGCAGCAGCAGCAGCAG is changed to CAGCAGCAGCAGCAGCAGCAG.
5. the sequence AACGTTATCG is changed to AATGTTATCG.
6. the sequence AACGTCACACACATCG is changed to AACGTCACATCG.
7. the sequence AAGCTTATCG is changed to AAGCTTTATCG.
Introduction:
In this particular case, the exposure of X-rays is responsible for deletion mutation from the wild type sequence.
Answer to Problem 1P
Correct answer:
the sequence AAGCTTATCG is changed to AAGCTATCG: deletion and X-ray irradiation.
Explanation of Solution
If both, wild type and mutated sequence are observed that it can be seen that there is a deletion of nitrogenous base T from wild type sequence. The exposure to X-ray irradiation may be responsible for deletion mutation. Thus, the correct match for the given mutation is deletion and X-ray irradiation.
4.
To determine:
The item that describes “the sequence CAGCAGCAGCAGCAGCAG is changed to CAGCAGCAGCAGCAGCAGCAG”.
1. an A-T base pair in the wild-type gene is changed to a G-C pair.
2. an A-T base pair is changed to a T-A pair.
3. the sequence AAGCTTATCG is changed to AAGCTATCG.
4. the sequence CAGCAGCAGCAGCAGCAG is changed to CAGCAGCAGCAGCAGCAGCAG.
5. the sequence AACGTTATCG is changed to AATGTTATCG.
6. the sequence AACGTCACACACATCG is changed to AACGTCACATCG.
7. the sequence AAGCTTATCG is changed to AAGCTTTATCG.
Introduction:
When one or more nitrogenous bases are added to a specific sequence of nucleotides, then the process of insertion takes place.
Answer to Problem 1P
Correct answer:
The sequence CAGCAGCAGCAGCAGCAG is changed to CAGCAGCAGCAGCAGCAGCAG: insertion and intercalator.
Explanation of Solution
Insertion is a mutation in which a nitrogenous base or a group of the nitrogenous bases are added to a sequence. In the given mutation, a thymine residue is added to the wild type sequence for mutation. Thus, the kind of mutation is an insertion, and it can result from the introduction of some chemical mutagens like ethidium bromide. These chemical mutagens are intercalated with sequence and are known as intercalators. Thus, the correct match for the given mutation is insertion and intercalator.
5.
To determine:
The item that describes “the sequence AACGTTATCG is changed to AATGTTATCG”.
1. an A-T base pair in the wild-type gene is changed to a G-C pair.
2. an A-T base pair is changed to a T-A pair.
3. the sequence AAGCTTATCG is changed to AAGCTATCG.
4. the sequence CAGCAGCAGCAGCAGCAG is changed to CAGCAGCAGCAGCAGCAGCAG.
5. the sequence AACGTTATCG is changed to AATGTTATCG.
6. the sequence AACGTCACACACATCG is changed to AACGTCACATCG.
7. the sequence AAGCTTATCG is changed to AAGCTTTATCG.
Introduction:
Transition is the change of one purine to another purine or one pyrimidine to another pyrimidine.
Answer to Problem 1P
Correct answer:
the sequence AACGTTATCG is changed to AATGTTATCG: base substitution, transition, and deamination.
Explanation of Solution
In the given mutation, base T is exchanged with base C so it can be a base substitution. This can also be a transition mutation because cytosine is a pyrimidine which is interchanged with another pyrimidine that is thymine. Deamination can also be noticed in the given mutation because the conversion of a methylated C to T is taking place. Thus, the correct match for the given mutation is a substitution, transition, and deamination.
6.
To determine:
The item that describes “the sequence AACGTCACACACATCG is changed to AACGTCACATCG”.
1. an A-T base pair in the wild-type gene is changed to a G-C pair.
2. an A-T base pair is changed to a T-A pair.
3. the sequence AAGCTTATCG is changed to AAGCTATCG.
4. the sequence CAGCAGCAGCAGCAGCAG is changed to CAGCAGCAGCAGCAGCAGCAG.
5. the sequence AACGTTATCG is changed to AATGTTATCG.
6. the sequence AACGTCACACACATCG is changed to AACGTCACATCG.
7. the sequence AAGCTTATCG is changed to AAGCTTTATCG.
Introduction:
Crossing over is the process of exchange of genetic material between the sister chromatids at chiasmata.
Answer to Problem 1P
Correct answer:
The sequence AACGTCACACACATCG is changed to AACGTCACATCG: deletion and crossing over.
Explanation of Solution
In the given mutation, it can be noticed that a segment CACACACA has been lost from wild type sequence, so it is representing deletion. A segment can be removed from the wild type gene during the process of crossing over. Thus, the correct match for the given mutation is deletion and crossing over.
7.
To determine:
The item that describes “the sequence AAGCTTATCG is changed to AAGCTTTATCG”.
1. an A-T base pair in the wild-type gene is changed to a G-C pair.
2. an A-T base pair is changed to a T-A pair.
3. the sequence AAGCTTATCG is changed to AAGCTATCG.
4. the sequence CAGCAGCAGCAGCAGCAG is changed to CAGCAGCAGCAGCAGCAGCAG.
5. the sequence AACGTTATCG is changed to AATGTTATCG.
6. the sequence AACGTCACACACATCG is changed to AACGTCACATCG.
7. the sequence AAGCTTATCG is changed to AAGCTTTATCG.
Introduction:
When one or more nitrogenous bases are removed from the nucleotide sequence, then the process is called deletion.
Answer to Problem 1P
Correct answer:
the sequence AAGCTTATCG is changed to AAGCTTTATCG: deletion and X-ray irradiation.
Explanation of Solution
Observation of wild type and mutated sequence can lead to a conclusion that there is a deletion of nitrogenous base T from wild type sequence. Deletion mutation may happen to because of exposure to X-ray irradiation. Thus, the correct match for the given mutation is deletion and X-ray irradiation.
Want to see more full solutions like this?
Chapter 7 Solutions
Genetics: From Genes to Genomes
Additional Science Textbook Solutions
Campbell Essential Biology (7th Edition)
Organic Chemistry
Microbiology Fundamentals: A Clinical Approach
Human Physiology: An Integrated Approach (8th Edition)
Laboratory Manual For Human Anatomy & Physiology
- A wildtype gene produces the polypeptide sequence: Wildtype: Met-Ser-Pro-Arg-Leu-Glu-Gly Each of the following polypeptide sequences is the result of a single mutation. Identify the most likely type of mutation causing each, be as specific as possible. M1:Met-Ser-Ser-Arg-Leu-Glu-Gly missense mutation M2:Met-Ser-Pro M3:Met-Ser-Pro-Asp-Trp-Arg-Asp-Lys M4:Met-Ser-Pro-Glu-Gly nonsense mutation frameshift insertion in frame deletion M5:Met-Ser-Pro-Arg-Leu-Glu-Gly in frame insertionarrow_forwardYou have the following DNA coding sequence of a wild-type allele: 5’-ATG TTC CAG CTA GAT GAT ATG CTG GTA ATT GGG GAA CGC GCG CGG TAA-3’ For each of the following mutations: A. State whether the mutation is missense, nonsense, frameshift, or silent. B. Write the codon change that occurs for the missense, nonsense, and silent mutations (ex. GAA -- GAT). C. For frameshift mutations, write out the entire mutant sequence with each codon clearly indicated (if the frameshift creates a new stop codon, end the sequence at the new stop). Using the wild type DNA sequence above as a guide : Write the amino acid sequence of the mutants. Mutant 1: transition at nucleotide 23 Mutant 2: T --> G transversion at nucleotide 29 Mutant 3: an insertion of “A” after nucleotide 14 Mutant 4: transition at nucleotide 7 Mutant 5: An insertion of GG after nucleotide 40 Mutant 6: transition at nucleotide 15 Mutant 7: a deletion of nucleotide 25arrow_forwarda. Some antibiotics, such as rifampin, interfere with the function of RNA polymerase. What biological process is rifampin disrupting? b. Some antibiotic-resistant M. tuberculosis bacteria have a single point mutation (CàT) in the rpoB gene that causes an amino acid change from serine (a polar amino acid) to leucine (a non-polar amino acid). What type of mutation is this? Do you expect this to have no effect, a small effect, or a large effect on the polypeptide produced? Explain your reasoning. c. The rpoB gene encodes a subunit of the bacterial RNA polymerase protein. The point mutation described in Question 2 causes a change in protein folding, which leads to the inability of the rifampin antibiotic to bind to the RNA polymerase. Which level(s) of protein structure is/are affected by this change?arrow_forward
- There are five substitution mutations in the dark-colored mutant Mc1r gene. Compare the DNA sequence of the light-colored wild-type Mc1r gene with the DNA sequence of the dark-colored mutant Mc1r gene. Indicate the locations of the five mutations by changing the font color to YELLOW for the five single DNA nucleotidesthat are mutated in the mutant Mc1r gene table. Using the information in the introduction, determine whether each of these mutations is a silent, missense, or nonsense mutation. Using the mutant Mc1r gene data, fill in the columns (including DNA, mRNA, and amino acid) in gene table 2 that contain a silent mutation with BLUE. Likewise, fill in the columns that contain a missense mutation with RED. Shade any columns that contain nonsense mutations with GREEN.arrow_forwardIs each of the following mutations a silent, missense, nonsense, orframeshift mutation? The original DNA strand is 5′–ATGGGACTAGATACC–3′. (Note: Only the coding strand is shown; the firstcodon is methionine.)A. 5′–ATGGGTCTAGATACC–3′B. 5′–ATGCGACTAGATACC–3′C. 5′–ATGGGACTAGTTACC–3′D. 5′–ATGGGACTAAGATACC–3′arrow_forwardIdentify the best match between the mutation description and term. a. Transversion: results in a change in single nucleotide from a purine to another purine or a pyrimidine to another pyrimidine b. Nonsense mutation: a change in the DNA that changes the codon code from one amino acid to another amino acid c. Missense mutation: causes a drastic change in phenotype because the change causes a premature stop in the amino acid sequence d. Indel: has the potential to cause large changes in transcription and subsequence amino acid sequence due to reading frameshiftsarrow_forward
- There are five substitution mutations in the dark-colored mutant Mc1r gene. Compare the DNA sequence of the light-colored wild-type Mc1r gene with the DNA sequence of the dark-colored mutant Mc1r gene. Indicate the locations of the five mutations by changing the font color to YELLOW for the five single DNA nucleotides that are mutated in the mutant Mc1r gene table. Using the information in the introduction, determine whether each of these mutations is a silent, missense, or nonsense mutation. Using the mutant Mc1r gene data, fill in the columns (including DNA, mRNA, and amino acid) in gene table 2 that contain a silent mutation with BLUE. Likewise, fill in the columns that contain a missense mutation with RED. Shade any columns that contain nonsense mutations with GREEN. Then Of the five mutations you identified in the mutant Mc1r gene, how many are: substitutions insertions deletions (Enter a number on each line.) 2. Of the five mutations…arrow_forwardYou have a patient in your clinic presenting symptoms of cystic fibrosis. You screen their CFTR gene for mutations, and find the following list: CFTR 320 L V CFTR 341 S W CFTR 528 E D CFTR 976 F Q CFTR 1235 S R Which mutation(s) are likely causing cystic fibrosis in this patient? You also sequence a newborn family member of this patient. They have all of these same mutations, other than the one at position 976, and no other mutations in CFTR. Do you predict this person will develop cystic fibrosis? Explain why.arrow_forward1). In the absence of this enzyme, a substance called ceroid lipofuscin accumulates in lysosomes in the brain, resulting in seizures, blindness, decline in cognitive function and motor skills, dementia, and death by the late teens or early 20’s. The TPP1 gene is 6695 bp in length. Think about the characteristics of Batten disease, and then suggest an approach to gene therapy that might be effective for this specific genetic disorder. You may assume that your research team is working in the U.S. and your research is funded by a grant from the National Institutes of Health (NIH). a) Hypothetically, what specific type of VECTOR will you use to perform your gene therapy? Please select from the following list of potential vectors: disabled retrovirus, adenovirus, adeno-associated virus (AAV), or herpes simplex virus (HSV), then give two reasons why this specific vector is the most appropriate for your gene therapy. Please explain why you were able to rule out the other potential…arrow_forward
- 1). In the absence of this enzyme, a substance called ceroid lipofuscin accumulates in lysosomes in the brain, resulting in seizures, blindness, decline in cognitive function and motor skills, dementia, and death by the late teens or early 20’s. The TPP1 gene is 6695 bp in length. Think about the characteristics of Batten disease, and then suggest an approach to gene therapy that might be effective for this specific genetic disorder. You may assume that your research team is working in the U.S. and your research is funded by a grant from the National Institutes of Health (NIH). Please EXCLUDE the use of CRISPR from consideration. A. Will you use germline or somatic cell gene therapy? Please NAME and DEFINE the form of gene therapy selected, then explain WHY this is the most appropriate choice.arrow_forward1). In the absence of this enzyme, a substance called ceroid lipofuscin accumulates in lysosomes in the brain, resulting in seizures, blindness, decline in cognitive function and motor skills, dementia, and death by the late teens or early 20’s. The TPP1 gene is 6695 bp in length. Think about the characteristics of Batten disease, and then suggest an approach to gene therapy that might be effective for this specific genetic disorder. You may assume that your research team is working in the U.S. and your research is funded by a grant from the National Institutes of Health (NIH). Other scientists have suggested that it might be possible to use CRISPR to treat this genetic disorder in affected individuals. (i) First, what is CRISPR? (BRIEFLY describe what it is and how it works). (ii) Briefly describe how CRISPR could be utilized in treating genetic conditions such as Batten disease.arrow_forwardThe genetic alteration responsible for sickle-cell anemia in humans involves: a transition mutation from A to G, substituting glutamic acid for valine in a-globin a transversion mutation from T to A, substituting valine for glutamic acid in b-globin a transition mutation from T to C, substituting valine for glutamic acid in b-globin a transversion mutation from G to C, substituting glutamic acid for valine in a-globin a frameshift mutation of one ATC codon, removing glutamic acid from b-globinarrow_forward
Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning