The following is a list of mutational changes. For each of the specific mutations described, indicate which of the terms in the right-hand column applies, either as a description of the mutation or as a possible cause. More than one term from the right column can apply to each statement in the left column. 1. an A-T base pair in the wild-type gene is changed to a G-C pair a. transition 2. an A-T base pair is changed to a T-A pair b. base substitution 3. the sequence AAGCTTATCG is changed to AAGCTATCG c. transversion 4. the sequence CAGCAGCAGCAGCAGCAG is changed to CAGCAGCAGCAGCAGCAGCAG d. deletion 5. the sequence AACGTTATCG is changed to AATGTTATCG e. insertion 6. the sequence AACGTCACACACATCG is changed to AACGTCACATCG f. deamination 7. the sequence AAGCTTATCG is changed to AAGCTTTATCG g. X-ray irradiation h. intercalator i. slipped mispairing

Question

Want to see more full solutions like this?

Answer 1

Textbook Question

Chapter 7, Problem 1P

The following is a list of mutational changes. For each of the specific mutations described, indicate which of the terms in the right-hand column applies, either as a description of the mutation or as a possible cause. More than one term from the right column can apply to each statement in the left column.

1. an A-T base pair in the wild-type gene is changed to a G-C pair	a. transition
2. an A-T base pair is changed to a T-A pair	b. base substitution
3. the sequence AAGCTTATCG is changed to AAGCTATCG	c. transversion
4. the sequence CAGCAGCAGCAGCAGCAG is changed to CAGCAGCAGCAGCAGCAGCAG	d. deletion
5. the sequence AACGTTATCG is changed to AATGTTATCG	e. insertion
6. the sequence AACGTCACACACATCG is changed to AACGTCACATCG	f. deamination
7. the sequence AAGCTTATCG is changed to AAGCTTTATCG	g. X-ray irradiation
	h. intercalator
	i. slipped mispairing

Expert Solution

Summary Introduction

1.

To determine:

The item that describes “an A-T base pair in the wild-type gene is changed to a G-C pair.”

1. an A-T base pair in the wild-type gene is changed to a G-C pair.

2. an A-T base pair is changed to a T-A pair.

3. the sequence AAGCTTATCG is changed to AAGCTATCG.

4. the sequence CAGCAGCAGCAGCAGCAG is changed to CAGCAGCAGCAGCAGCAGCAG.

5. the sequence AACGTTATCG is changed to AATGTTATCG.

6. the sequence AACGTCACACACATCG is changed to AACGTCACATCG.

7. the sequence AAGCTTATCG is changed to AAGCTTTATCG.

Introduction:

When purines and pyrimidines are exchanged with each other, the process is called transition.

Answer to Problem 1P

Correct answer:

An A-T base pair in the wild-type gene is changed to a G-C pair: transition and base substitution.

Explanation of Solution

In the given mutation, A-T base pair is exchanged with a G-C base pair so it can be a base substitution. This can also be a transition mutation because adenine is a purine which is interchanged with another purine that is guanine. Thymine replaced the cytosine, and both are also pyrimidines. Thus, this condition can be a base substitution mutation or a transition mutation.

Expert Solution

Summary Introduction

2.

To determine:

The item that describes “an A-T base pair is changed to a T-A pair”.

1. an A-T base pair in the wild-type gene is changed to a G-C pair.

2. an A-T base pair is changed to a T-A pair.

3. the sequence AAGCTTATCG is changed to AAGCTATCG.

4. the sequence CAGCAGCAGCAGCAGCAG is changed to CAGCAGCAGCAGCAGCAGCAG.

5. the sequence AACGTTATCG is changed to AATGTTATCG.

6. the sequence AACGTCACACACATCG is changed to AACGTCACATCG.

7. the sequence AAGCTTATCG is changed to AAGCTTTATCG.

Introduction:

When one purine is replaced by pyrimidine in a pair of two bases, the resulting process is called transversion.

Answer to Problem 1P

Correct answer:

an A-T base pair is changed to a T-A pair: base substitution and transversion.

Explanation of Solution

In the given mutation, a base pair ‘A-T’ can be changed to a ‘T-A’ base-pair so the replacement of one purine with pyrimidine can be observed. Thus, the mutation for concerting A-T into T-A can be a transversion. The substitution of A by T is taking place so, it can also be a base substitution mutation.

Expert Solution

Summary Introduction

3.

To determine:

The item that describes “the sequence AAGCTTATCG is changed to AAGCTATCG”.

1. an A-T base pair in the wild-type gene is changed to a G-C pair.

2. an A-T base pair is changed to a T-A pair.

3. the sequence AAGCTTATCG is changed to AAGCTATCG.

4. the sequence CAGCAGCAGCAGCAGCAG is changed to CAGCAGCAGCAGCAGCAGCAG.

5. the sequence AACGTTATCG is changed to AATGTTATCG.

6. the sequence AACGTCACACACATCG is changed to AACGTCACATCG.

7. the sequence AAGCTTATCG is changed to AAGCTTTATCG.

Introduction:

In this particular case, the exposure of X-rays is responsible for deletion mutation from the wild type sequence.

Answer to Problem 1P

Correct answer:

the sequence AAGCTTATCG is changed to AAGCTATCG: deletion and X-ray irradiation.

Explanation of Solution

If both, wild type and mutated sequence are observed that it can be seen that there is a deletion of nitrogenous base T from wild type sequence. The exposure to X-ray irradiation may be responsible for deletion mutation. Thus, the correct match for the given mutation is deletion and X-ray irradiation.

Expert Solution

Summary Introduction

4.

To determine:

The item that describes “the sequence CAGCAGCAGCAGCAGCAG is changed to CAGCAGCAGCAGCAGCAGCAG”.

1. an A-T base pair in the wild-type gene is changed to a G-C pair.

2. an A-T base pair is changed to a T-A pair.

3. the sequence AAGCTTATCG is changed to AAGCTATCG.

4. the sequence CAGCAGCAGCAGCAGCAG is changed to CAGCAGCAGCAGCAGCAGCAG.

5. the sequence AACGTTATCG is changed to AATGTTATCG.

6. the sequence AACGTCACACACATCG is changed to AACGTCACATCG.

7. the sequence AAGCTTATCG is changed to AAGCTTTATCG.

Introduction:

When one or more nitrogenous bases are added to a specific sequence of nucleotides, then the process of insertion takes place.

Answer to Problem 1P

Correct answer:

The sequence CAGCAGCAGCAGCAGCAG is changed to CAGCAGCAGCAGCAGCAGCAG: insertion and intercalator.

Explanation of Solution

Insertion is a mutation in which a nitrogenous base or a group of the nitrogenous bases are added to a sequence. In the given mutation, a thymine residue is added to the wild type sequence for mutation. Thus, the kind of mutation is an insertion, and it can result from the introduction of some chemical mutagens like ethidium bromide. These chemical mutagens are intercalated with sequence and are known as intercalators. Thus, the correct match for the given mutation is insertion and intercalator.

Expert Solution

Summary Introduction

5.

To determine:

The item that describes “the sequence AACGTTATCG is changed to AATGTTATCG”.

1. an A-T base pair in the wild-type gene is changed to a G-C pair.

2. an A-T base pair is changed to a T-A pair.

3. the sequence AAGCTTATCG is changed to AAGCTATCG.

4. the sequence CAGCAGCAGCAGCAGCAG is changed to CAGCAGCAGCAGCAGCAGCAG.

5. the sequence AACGTTATCG is changed to AATGTTATCG.

6. the sequence AACGTCACACACATCG is changed to AACGTCACATCG.

7. the sequence AAGCTTATCG is changed to AAGCTTTATCG.

Introduction:

Transition is the change of one purine to another purine or one pyrimidine to another pyrimidine.

Answer to Problem 1P

Correct answer:

the sequence AACGTTATCG is changed to AATGTTATCG: base substitution, transition, and deamination.

Explanation of Solution

In the given mutation, base T is exchanged with base C so it can be a base substitution. This can also be a transition mutation because cytosine is a pyrimidine which is interchanged with another pyrimidine that is thymine. Deamination can also be noticed in the given mutation because the conversion of a methylated C to T is taking place. Thus, the correct match for the given mutation is a substitution, transition, and deamination.

Expert Solution

Summary Introduction

6.

To determine:

The item that describes “the sequence AACGTCACACACATCG is changed to AACGTCACATCG”.

1. an A-T base pair in the wild-type gene is changed to a G-C pair.

2. an A-T base pair is changed to a T-A pair.

3. the sequence AAGCTTATCG is changed to AAGCTATCG.

4. the sequence CAGCAGCAGCAGCAGCAG is changed to CAGCAGCAGCAGCAGCAGCAG.

5. the sequence AACGTTATCG is changed to AATGTTATCG.

6. the sequence AACGTCACACACATCG is changed to AACGTCACATCG.

7. the sequence AAGCTTATCG is changed to AAGCTTTATCG.

Introduction:

Crossing over is the process of exchange of genetic material between the sister chromatids at chiasmata.

Answer to Problem 1P

Correct answer:

The sequence AACGTCACACACATCG is changed to AACGTCACATCG: deletion and crossing over.

Explanation of Solution

In the given mutation, it can be noticed that a segment CACACACA has been lost from wild type sequence, so it is representing deletion. A segment can be removed from the wild type gene during the process of crossing over. Thus, the correct match for the given mutation is deletion and crossing over.

Expert Solution

Summary Introduction

7.

To determine:

The item that describes “the sequence AAGCTTATCG is changed to AAGCTTTATCG”.

1. an A-T base pair in the wild-type gene is changed to a G-C pair.

2. an A-T base pair is changed to a T-A pair.

3. the sequence AAGCTTATCG is changed to AAGCTATCG.

4. the sequence CAGCAGCAGCAGCAGCAG is changed to CAGCAGCAGCAGCAGCAGCAG.

5. the sequence AACGTTATCG is changed to AATGTTATCG.

6. the sequence AACGTCACACACATCG is changed to AACGTCACATCG.

7. the sequence AAGCTTATCG is changed to AAGCTTTATCG.

Introduction:

When one or more nitrogenous bases are removed from the nucleotide sequence, then the process is called deletion.

Answer to Problem 1P

Correct answer:

the sequence AAGCTTATCG is changed to AAGCTTTATCG: deletion and X-ray irradiation.

Explanation of Solution

Observation of wild type and mutated sequence can lead to a conclusion that there is a deletion of nitrogenous base T from wild type sequence. Deletion mutation may happen to because of exposure to X-ray irradiation. Thus, the correct match for the given mutation is deletion and X-ray irradiation.

Want to see more full solutions like this?

Subscribe now to access step-by-step solutions to millions of textbook problems written by subject matter experts!

Students have asked these similar questions

Which of the following is the process that is "capable of destroying all forms of microbial life"? Question 37 options: Surgical scrub Sterilization Chemical removal Mechanical removal

After you feel comfortable with your counting method and identifying cells in the various stages of mitosis, use the four images below of whitefish blastula to count the cells in each stage until you reach 100 total cells, recording your data below in Data Table 1. (You may not need to use all four images. Stop counting when you reach 100 total cells.) After totaling the cells in each stage, calculate the percent of cells in each stage. (Divide total of stage by overall total of 100 and then multiply by 100 to obtain percentage.) Data Table 1Stage Totals PercentInterphase Mitosis: Prophase Metaphase Anaphase Telophase Cytokinesis Totals 100 100% To find the length of time whitefish blastula cells spend in each stage, multiply the percent (recorded as a decimal, in other words take the percent number and divide by 100) by 24 hours. (Example: If percent is 20%, then Time in Hours = .2 * 24 = 4.8) Record your data in Data…

What are Clathrin coated vesicles and what is their function?

Answer 2

Textbook Question

Chapter 7, Problem 1P

The following is a list of mutational changes. For each of the specific mutations described, indicate which of the terms in the right-hand column applies, either as a description of the mutation or as a possible cause. More than one term from the right column can apply to each statement in the left column.

1. an A-T base pair in the wild-type gene is changed to a G-C pair	a. transition
2. an A-T base pair is changed to a T-A pair	b. base substitution
3. the sequence AAGCTTATCG is changed to AAGCTATCG	c. transversion
4. the sequence CAGCAGCAGCAGCAGCAG is changed to CAGCAGCAGCAGCAGCAGCAG	d. deletion
5. the sequence AACGTTATCG is changed to AATGTTATCG	e. insertion
6. the sequence AACGTCACACACATCG is changed to AACGTCACATCG	f. deamination
7. the sequence AAGCTTATCG is changed to AAGCTTTATCG	g. X-ray irradiation
	h. intercalator
	i. slipped mispairing

Expert Solution

Summary Introduction

1.

To determine:

The item that describes “an A-T base pair in the wild-type gene is changed to a G-C pair.”

1. an A-T base pair in the wild-type gene is changed to a G-C pair.

2. an A-T base pair is changed to a T-A pair.

3. the sequence AAGCTTATCG is changed to AAGCTATCG.

4. the sequence CAGCAGCAGCAGCAGCAG is changed to CAGCAGCAGCAGCAGCAGCAG.

5. the sequence AACGTTATCG is changed to AATGTTATCG.

6. the sequence AACGTCACACACATCG is changed to AACGTCACATCG.

7. the sequence AAGCTTATCG is changed to AAGCTTTATCG.

Introduction:

When purines and pyrimidines are exchanged with each other, the process is called transition.

Answer to Problem 1P

Correct answer:

An A-T base pair in the wild-type gene is changed to a G-C pair: transition and base substitution.

Explanation of Solution

In the given mutation, A-T base pair is exchanged with a G-C base pair so it can be a base substitution. This can also be a transition mutation because adenine is a purine which is interchanged with another purine that is guanine. Thymine replaced the cytosine, and both are also pyrimidines. Thus, this condition can be a base substitution mutation or a transition mutation.

Expert Solution

Summary Introduction

2.

To determine:

The item that describes “an A-T base pair is changed to a T-A pair”.

1. an A-T base pair in the wild-type gene is changed to a G-C pair.

2. an A-T base pair is changed to a T-A pair.

3. the sequence AAGCTTATCG is changed to AAGCTATCG.

4. the sequence CAGCAGCAGCAGCAGCAG is changed to CAGCAGCAGCAGCAGCAGCAG.

5. the sequence AACGTTATCG is changed to AATGTTATCG.

6. the sequence AACGTCACACACATCG is changed to AACGTCACATCG.

7. the sequence AAGCTTATCG is changed to AAGCTTTATCG.

Introduction:

When one purine is replaced by pyrimidine in a pair of two bases, the resulting process is called transversion.

Answer to Problem 1P

Correct answer:

an A-T base pair is changed to a T-A pair: base substitution and transversion.

Explanation of Solution

In the given mutation, a base pair ‘A-T’ can be changed to a ‘T-A’ base-pair so the replacement of one purine with pyrimidine can be observed. Thus, the mutation for concerting A-T into T-A can be a transversion. The substitution of A by T is taking place so, it can also be a base substitution mutation.

Expert Solution

Summary Introduction

3.

To determine:

The item that describes “the sequence AAGCTTATCG is changed to AAGCTATCG”.

1. an A-T base pair in the wild-type gene is changed to a G-C pair.

2. an A-T base pair is changed to a T-A pair.

3. the sequence AAGCTTATCG is changed to AAGCTATCG.

4. the sequence CAGCAGCAGCAGCAGCAG is changed to CAGCAGCAGCAGCAGCAGCAG.

5. the sequence AACGTTATCG is changed to AATGTTATCG.

6. the sequence AACGTCACACACATCG is changed to AACGTCACATCG.

7. the sequence AAGCTTATCG is changed to AAGCTTTATCG.

Introduction:

In this particular case, the exposure of X-rays is responsible for deletion mutation from the wild type sequence.

Answer to Problem 1P

Correct answer:

the sequence AAGCTTATCG is changed to AAGCTATCG: deletion and X-ray irradiation.

Explanation of Solution

If both, wild type and mutated sequence are observed that it can be seen that there is a deletion of nitrogenous base T from wild type sequence. The exposure to X-ray irradiation may be responsible for deletion mutation. Thus, the correct match for the given mutation is deletion and X-ray irradiation.

Expert Solution

Summary Introduction

4.

To determine:

The item that describes “the sequence CAGCAGCAGCAGCAGCAG is changed to CAGCAGCAGCAGCAGCAGCAG”.

1. an A-T base pair in the wild-type gene is changed to a G-C pair.

2. an A-T base pair is changed to a T-A pair.

3. the sequence AAGCTTATCG is changed to AAGCTATCG.

4. the sequence CAGCAGCAGCAGCAGCAG is changed to CAGCAGCAGCAGCAGCAGCAG.

5. the sequence AACGTTATCG is changed to AATGTTATCG.

6. the sequence AACGTCACACACATCG is changed to AACGTCACATCG.

7. the sequence AAGCTTATCG is changed to AAGCTTTATCG.

Introduction:

When one or more nitrogenous bases are added to a specific sequence of nucleotides, then the process of insertion takes place.

Answer to Problem 1P

Correct answer:

The sequence CAGCAGCAGCAGCAGCAG is changed to CAGCAGCAGCAGCAGCAGCAG: insertion and intercalator.

Explanation of Solution

Insertion is a mutation in which a nitrogenous base or a group of the nitrogenous bases are added to a sequence. In the given mutation, a thymine residue is added to the wild type sequence for mutation. Thus, the kind of mutation is an insertion, and it can result from the introduction of some chemical mutagens like ethidium bromide. These chemical mutagens are intercalated with sequence and are known as intercalators. Thus, the correct match for the given mutation is insertion and intercalator.

Expert Solution

Summary Introduction

5.

To determine:

The item that describes “the sequence AACGTTATCG is changed to AATGTTATCG”.

1. an A-T base pair in the wild-type gene is changed to a G-C pair.

2. an A-T base pair is changed to a T-A pair.

3. the sequence AAGCTTATCG is changed to AAGCTATCG.

4. the sequence CAGCAGCAGCAGCAGCAG is changed to CAGCAGCAGCAGCAGCAGCAG.

5. the sequence AACGTTATCG is changed to AATGTTATCG.

6. the sequence AACGTCACACACATCG is changed to AACGTCACATCG.

7. the sequence AAGCTTATCG is changed to AAGCTTTATCG.

Introduction:

Transition is the change of one purine to another purine or one pyrimidine to another pyrimidine.

Answer to Problem 1P

Correct answer:

the sequence AACGTTATCG is changed to AATGTTATCG: base substitution, transition, and deamination.

Explanation of Solution

In the given mutation, base T is exchanged with base C so it can be a base substitution. This can also be a transition mutation because cytosine is a pyrimidine which is interchanged with another pyrimidine that is thymine. Deamination can also be noticed in the given mutation because the conversion of a methylated C to T is taking place. Thus, the correct match for the given mutation is a substitution, transition, and deamination.

Expert Solution

Summary Introduction

6.

To determine:

The item that describes “the sequence AACGTCACACACATCG is changed to AACGTCACATCG”.

1. an A-T base pair in the wild-type gene is changed to a G-C pair.

2. an A-T base pair is changed to a T-A pair.

3. the sequence AAGCTTATCG is changed to AAGCTATCG.

4. the sequence CAGCAGCAGCAGCAGCAG is changed to CAGCAGCAGCAGCAGCAGCAG.

5. the sequence AACGTTATCG is changed to AATGTTATCG.

6. the sequence AACGTCACACACATCG is changed to AACGTCACATCG.

7. the sequence AAGCTTATCG is changed to AAGCTTTATCG.

Introduction:

Crossing over is the process of exchange of genetic material between the sister chromatids at chiasmata.

Answer to Problem 1P

Correct answer:

The sequence AACGTCACACACATCG is changed to AACGTCACATCG: deletion and crossing over.

Explanation of Solution

In the given mutation, it can be noticed that a segment CACACACA has been lost from wild type sequence, so it is representing deletion. A segment can be removed from the wild type gene during the process of crossing over. Thus, the correct match for the given mutation is deletion and crossing over.

Expert Solution

Summary Introduction

7.

To determine:

The item that describes “the sequence AAGCTTATCG is changed to AAGCTTTATCG”.

1. an A-T base pair in the wild-type gene is changed to a G-C pair.

2. an A-T base pair is changed to a T-A pair.

3. the sequence AAGCTTATCG is changed to AAGCTATCG.

4. the sequence CAGCAGCAGCAGCAGCAG is changed to CAGCAGCAGCAGCAGCAGCAG.

5. the sequence AACGTTATCG is changed to AATGTTATCG.

6. the sequence AACGTCACACACATCG is changed to AACGTCACATCG.

7. the sequence AAGCTTATCG is changed to AAGCTTTATCG.

Introduction:

When one or more nitrogenous bases are removed from the nucleotide sequence, then the process is called deletion.

Answer to Problem 1P

Correct answer:

the sequence AAGCTTATCG is changed to AAGCTTTATCG: deletion and X-ray irradiation.

Explanation of Solution

Observation of wild type and mutated sequence can lead to a conclusion that there is a deletion of nitrogenous base T from wild type sequence. Deletion mutation may happen to because of exposure to X-ray irradiation. Thus, the correct match for the given mutation is deletion and X-ray irradiation.

Want to see more full solutions like this?

Subscribe now to access step-by-step solutions to millions of textbook problems written by subject matter experts!

Answer 3

Textbook Question

Chapter 7, Problem 1P

The following is a list of mutational changes. For each of the specific mutations described, indicate which of the terms in the right-hand column applies, either as a description of the mutation or as a possible cause. More than one term from the right column can apply to each statement in the left column.

1. an A-T base pair in the wild-type gene is changed to a G-C pair	a. transition
2. an A-T base pair is changed to a T-A pair	b. base substitution
3. the sequence AAGCTTATCG is changed to AAGCTATCG	c. transversion
4. the sequence CAGCAGCAGCAGCAGCAG is changed to CAGCAGCAGCAGCAGCAGCAG	d. deletion
5. the sequence AACGTTATCG is changed to AATGTTATCG	e. insertion
6. the sequence AACGTCACACACATCG is changed to AACGTCACATCG	f. deamination
7. the sequence AAGCTTATCG is changed to AAGCTTTATCG	g. X-ray irradiation
	h. intercalator
	i. slipped mispairing

Expert Solution

Summary Introduction

1.

To determine:

The item that describes “an A-T base pair in the wild-type gene is changed to a G-C pair.”

1. an A-T base pair in the wild-type gene is changed to a G-C pair.

2. an A-T base pair is changed to a T-A pair.

3. the sequence AAGCTTATCG is changed to AAGCTATCG.

4. the sequence CAGCAGCAGCAGCAGCAG is changed to CAGCAGCAGCAGCAGCAGCAG.

5. the sequence AACGTTATCG is changed to AATGTTATCG.

6. the sequence AACGTCACACACATCG is changed to AACGTCACATCG.

7. the sequence AAGCTTATCG is changed to AAGCTTTATCG.

Introduction:

When purines and pyrimidines are exchanged with each other, the process is called transition.

Answer to Problem 1P

Correct answer:

An A-T base pair in the wild-type gene is changed to a G-C pair: transition and base substitution.

Explanation of Solution

In the given mutation, A-T base pair is exchanged with a G-C base pair so it can be a base substitution. This can also be a transition mutation because adenine is a purine which is interchanged with another purine that is guanine. Thymine replaced the cytosine, and both are also pyrimidines. Thus, this condition can be a base substitution mutation or a transition mutation.

Expert Solution

Summary Introduction

2.

To determine:

The item that describes “an A-T base pair is changed to a T-A pair”.

1. an A-T base pair in the wild-type gene is changed to a G-C pair.

2. an A-T base pair is changed to a T-A pair.

3. the sequence AAGCTTATCG is changed to AAGCTATCG.

4. the sequence CAGCAGCAGCAGCAGCAG is changed to CAGCAGCAGCAGCAGCAGCAG.

5. the sequence AACGTTATCG is changed to AATGTTATCG.

6. the sequence AACGTCACACACATCG is changed to AACGTCACATCG.

7. the sequence AAGCTTATCG is changed to AAGCTTTATCG.

Introduction:

When one purine is replaced by pyrimidine in a pair of two bases, the resulting process is called transversion.

Answer to Problem 1P

Correct answer:

an A-T base pair is changed to a T-A pair: base substitution and transversion.

Explanation of Solution

In the given mutation, a base pair ‘A-T’ can be changed to a ‘T-A’ base-pair so the replacement of one purine with pyrimidine can be observed. Thus, the mutation for concerting A-T into T-A can be a transversion. The substitution of A by T is taking place so, it can also be a base substitution mutation.

Expert Solution

Summary Introduction

3.

To determine:

The item that describes “the sequence AAGCTTATCG is changed to AAGCTATCG”.

1. an A-T base pair in the wild-type gene is changed to a G-C pair.

2. an A-T base pair is changed to a T-A pair.

3. the sequence AAGCTTATCG is changed to AAGCTATCG.

4. the sequence CAGCAGCAGCAGCAGCAG is changed to CAGCAGCAGCAGCAGCAGCAG.

5. the sequence AACGTTATCG is changed to AATGTTATCG.

6. the sequence AACGTCACACACATCG is changed to AACGTCACATCG.

7. the sequence AAGCTTATCG is changed to AAGCTTTATCG.

Introduction:

In this particular case, the exposure of X-rays is responsible for deletion mutation from the wild type sequence.

Answer to Problem 1P

Correct answer:

the sequence AAGCTTATCG is changed to AAGCTATCG: deletion and X-ray irradiation.

Explanation of Solution

If both, wild type and mutated sequence are observed that it can be seen that there is a deletion of nitrogenous base T from wild type sequence. The exposure to X-ray irradiation may be responsible for deletion mutation. Thus, the correct match for the given mutation is deletion and X-ray irradiation.

Expert Solution

Summary Introduction

4.

To determine:

The item that describes “the sequence CAGCAGCAGCAGCAGCAG is changed to CAGCAGCAGCAGCAGCAGCAG”.

1. an A-T base pair in the wild-type gene is changed to a G-C pair.

2. an A-T base pair is changed to a T-A pair.

3. the sequence AAGCTTATCG is changed to AAGCTATCG.

4. the sequence CAGCAGCAGCAGCAGCAG is changed to CAGCAGCAGCAGCAGCAGCAG.

5. the sequence AACGTTATCG is changed to AATGTTATCG.

6. the sequence AACGTCACACACATCG is changed to AACGTCACATCG.

7. the sequence AAGCTTATCG is changed to AAGCTTTATCG.

Introduction:

When one or more nitrogenous bases are added to a specific sequence of nucleotides, then the process of insertion takes place.

Answer to Problem 1P

Correct answer:

The sequence CAGCAGCAGCAGCAGCAG is changed to CAGCAGCAGCAGCAGCAGCAG: insertion and intercalator.

Explanation of Solution

Insertion is a mutation in which a nitrogenous base or a group of the nitrogenous bases are added to a sequence. In the given mutation, a thymine residue is added to the wild type sequence for mutation. Thus, the kind of mutation is an insertion, and it can result from the introduction of some chemical mutagens like ethidium bromide. These chemical mutagens are intercalated with sequence and are known as intercalators. Thus, the correct match for the given mutation is insertion and intercalator.

Expert Solution

Summary Introduction

5.

To determine:

The item that describes “the sequence AACGTTATCG is changed to AATGTTATCG”.

1. an A-T base pair in the wild-type gene is changed to a G-C pair.

2. an A-T base pair is changed to a T-A pair.

3. the sequence AAGCTTATCG is changed to AAGCTATCG.

4. the sequence CAGCAGCAGCAGCAGCAG is changed to CAGCAGCAGCAGCAGCAGCAG.

5. the sequence AACGTTATCG is changed to AATGTTATCG.

6. the sequence AACGTCACACACATCG is changed to AACGTCACATCG.

7. the sequence AAGCTTATCG is changed to AAGCTTTATCG.

Introduction:

Transition is the change of one purine to another purine or one pyrimidine to another pyrimidine.

Answer to Problem 1P

Correct answer:

the sequence AACGTTATCG is changed to AATGTTATCG: base substitution, transition, and deamination.

Explanation of Solution

In the given mutation, base T is exchanged with base C so it can be a base substitution. This can also be a transition mutation because cytosine is a pyrimidine which is interchanged with another pyrimidine that is thymine. Deamination can also be noticed in the given mutation because the conversion of a methylated C to T is taking place. Thus, the correct match for the given mutation is a substitution, transition, and deamination.

Expert Solution

Summary Introduction

6.

To determine:

The item that describes “the sequence AACGTCACACACATCG is changed to AACGTCACATCG”.

1. an A-T base pair in the wild-type gene is changed to a G-C pair.

2. an A-T base pair is changed to a T-A pair.

3. the sequence AAGCTTATCG is changed to AAGCTATCG.

4. the sequence CAGCAGCAGCAGCAGCAG is changed to CAGCAGCAGCAGCAGCAGCAG.

5. the sequence AACGTTATCG is changed to AATGTTATCG.

6. the sequence AACGTCACACACATCG is changed to AACGTCACATCG.

7. the sequence AAGCTTATCG is changed to AAGCTTTATCG.

Introduction:

Crossing over is the process of exchange of genetic material between the sister chromatids at chiasmata.

Answer to Problem 1P

Correct answer:

The sequence AACGTCACACACATCG is changed to AACGTCACATCG: deletion and crossing over.

Explanation of Solution

In the given mutation, it can be noticed that a segment CACACACA has been lost from wild type sequence, so it is representing deletion. A segment can be removed from the wild type gene during the process of crossing over. Thus, the correct match for the given mutation is deletion and crossing over.

Expert Solution

Summary Introduction

7.

To determine:

The item that describes “the sequence AAGCTTATCG is changed to AAGCTTTATCG”.

1. an A-T base pair in the wild-type gene is changed to a G-C pair.

2. an A-T base pair is changed to a T-A pair.

3. the sequence AAGCTTATCG is changed to AAGCTATCG.

4. the sequence CAGCAGCAGCAGCAGCAG is changed to CAGCAGCAGCAGCAGCAGCAG.

5. the sequence AACGTTATCG is changed to AATGTTATCG.

6. the sequence AACGTCACACACATCG is changed to AACGTCACATCG.

7. the sequence AAGCTTATCG is changed to AAGCTTTATCG.

Introduction:

When one or more nitrogenous bases are removed from the nucleotide sequence, then the process is called deletion.

Answer to Problem 1P

Correct answer:

the sequence AAGCTTATCG is changed to AAGCTTTATCG: deletion and X-ray irradiation.

Explanation of Solution

Observation of wild type and mutated sequence can lead to a conclusion that there is a deletion of nitrogenous base T from wild type sequence. Deletion mutation may happen to because of exposure to X-ray irradiation. Thus, the correct match for the given mutation is deletion and X-ray irradiation.

Want to see more full solutions like this?

Subscribe now to access step-by-step solutions to millions of textbook problems written by subject matter experts!

Answer 4

Textbook Question

Chapter 7, Problem 1P

The following is a list of mutational changes. For each of the specific mutations described, indicate which of the terms in the right-hand column applies, either as a description of the mutation or as a possible cause. More than one term from the right column can apply to each statement in the left column.

1. an A-T base pair in the wild-type gene is changed to a G-C pair	a. transition
2. an A-T base pair is changed to a T-A pair	b. base substitution
3. the sequence AAGCTTATCG is changed to AAGCTATCG	c. transversion
4. the sequence CAGCAGCAGCAGCAGCAG is changed to CAGCAGCAGCAGCAGCAGCAG	d. deletion
5. the sequence AACGTTATCG is changed to AATGTTATCG	e. insertion
6. the sequence AACGTCACACACATCG is changed to AACGTCACATCG	f. deamination
7. the sequence AAGCTTATCG is changed to AAGCTTTATCG	g. X-ray irradiation
	h. intercalator
	i. slipped mispairing

Expert Solution

Summary Introduction

1.

To determine:

The item that describes “an A-T base pair in the wild-type gene is changed to a G-C pair.”

1. an A-T base pair in the wild-type gene is changed to a G-C pair.

2. an A-T base pair is changed to a T-A pair.

3. the sequence AAGCTTATCG is changed to AAGCTATCG.

4. the sequence CAGCAGCAGCAGCAGCAG is changed to CAGCAGCAGCAGCAGCAGCAG.

5. the sequence AACGTTATCG is changed to AATGTTATCG.

6. the sequence AACGTCACACACATCG is changed to AACGTCACATCG.

7. the sequence AAGCTTATCG is changed to AAGCTTTATCG.

Introduction:

When purines and pyrimidines are exchanged with each other, the process is called transition.

Answer to Problem 1P

Correct answer:

An A-T base pair in the wild-type gene is changed to a G-C pair: transition and base substitution.

Explanation of Solution

In the given mutation, A-T base pair is exchanged with a G-C base pair so it can be a base substitution. This can also be a transition mutation because adenine is a purine which is interchanged with another purine that is guanine. Thymine replaced the cytosine, and both are also pyrimidines. Thus, this condition can be a base substitution mutation or a transition mutation.

Expert Solution

Summary Introduction

2.

To determine:

The item that describes “an A-T base pair is changed to a T-A pair”.

1. an A-T base pair in the wild-type gene is changed to a G-C pair.

2. an A-T base pair is changed to a T-A pair.

3. the sequence AAGCTTATCG is changed to AAGCTATCG.

4. the sequence CAGCAGCAGCAGCAGCAG is changed to CAGCAGCAGCAGCAGCAGCAG.

5. the sequence AACGTTATCG is changed to AATGTTATCG.

6. the sequence AACGTCACACACATCG is changed to AACGTCACATCG.

7. the sequence AAGCTTATCG is changed to AAGCTTTATCG.

Introduction:

When one purine is replaced by pyrimidine in a pair of two bases, the resulting process is called transversion.

Answer to Problem 1P

Correct answer:

an A-T base pair is changed to a T-A pair: base substitution and transversion.

Explanation of Solution

In the given mutation, a base pair ‘A-T’ can be changed to a ‘T-A’ base-pair so the replacement of one purine with pyrimidine can be observed. Thus, the mutation for concerting A-T into T-A can be a transversion. The substitution of A by T is taking place so, it can also be a base substitution mutation.

Expert Solution

Summary Introduction

3.

To determine:

The item that describes “the sequence AAGCTTATCG is changed to AAGCTATCG”.

1. an A-T base pair in the wild-type gene is changed to a G-C pair.

2. an A-T base pair is changed to a T-A pair.

3. the sequence AAGCTTATCG is changed to AAGCTATCG.

4. the sequence CAGCAGCAGCAGCAGCAG is changed to CAGCAGCAGCAGCAGCAGCAG.

5. the sequence AACGTTATCG is changed to AATGTTATCG.

6. the sequence AACGTCACACACATCG is changed to AACGTCACATCG.

7. the sequence AAGCTTATCG is changed to AAGCTTTATCG.

Introduction:

In this particular case, the exposure of X-rays is responsible for deletion mutation from the wild type sequence.

Answer to Problem 1P

Correct answer:

the sequence AAGCTTATCG is changed to AAGCTATCG: deletion and X-ray irradiation.

Explanation of Solution

If both, wild type and mutated sequence are observed that it can be seen that there is a deletion of nitrogenous base T from wild type sequence. The exposure to X-ray irradiation may be responsible for deletion mutation. Thus, the correct match for the given mutation is deletion and X-ray irradiation.

Expert Solution

Summary Introduction

4.

To determine:

The item that describes “the sequence CAGCAGCAGCAGCAGCAG is changed to CAGCAGCAGCAGCAGCAGCAG”.

1. an A-T base pair in the wild-type gene is changed to a G-C pair.

2. an A-T base pair is changed to a T-A pair.

3. the sequence AAGCTTATCG is changed to AAGCTATCG.

4. the sequence CAGCAGCAGCAGCAGCAG is changed to CAGCAGCAGCAGCAGCAGCAG.

5. the sequence AACGTTATCG is changed to AATGTTATCG.

6. the sequence AACGTCACACACATCG is changed to AACGTCACATCG.

7. the sequence AAGCTTATCG is changed to AAGCTTTATCG.

Introduction:

When one or more nitrogenous bases are added to a specific sequence of nucleotides, then the process of insertion takes place.

Answer to Problem 1P

Correct answer:

The sequence CAGCAGCAGCAGCAGCAG is changed to CAGCAGCAGCAGCAGCAGCAG: insertion and intercalator.

Explanation of Solution

Insertion is a mutation in which a nitrogenous base or a group of the nitrogenous bases are added to a sequence. In the given mutation, a thymine residue is added to the wild type sequence for mutation. Thus, the kind of mutation is an insertion, and it can result from the introduction of some chemical mutagens like ethidium bromide. These chemical mutagens are intercalated with sequence and are known as intercalators. Thus, the correct match for the given mutation is insertion and intercalator.

Expert Solution

Summary Introduction

5.

To determine:

The item that describes “the sequence AACGTTATCG is changed to AATGTTATCG”.

1. an A-T base pair in the wild-type gene is changed to a G-C pair.

2. an A-T base pair is changed to a T-A pair.

3. the sequence AAGCTTATCG is changed to AAGCTATCG.

4. the sequence CAGCAGCAGCAGCAGCAG is changed to CAGCAGCAGCAGCAGCAGCAG.

5. the sequence AACGTTATCG is changed to AATGTTATCG.

6. the sequence AACGTCACACACATCG is changed to AACGTCACATCG.

7. the sequence AAGCTTATCG is changed to AAGCTTTATCG.

Introduction:

Transition is the change of one purine to another purine or one pyrimidine to another pyrimidine.

Answer to Problem 1P

Correct answer:

the sequence AACGTTATCG is changed to AATGTTATCG: base substitution, transition, and deamination.

Explanation of Solution

In the given mutation, base T is exchanged with base C so it can be a base substitution. This can also be a transition mutation because cytosine is a pyrimidine which is interchanged with another pyrimidine that is thymine. Deamination can also be noticed in the given mutation because the conversion of a methylated C to T is taking place. Thus, the correct match for the given mutation is a substitution, transition, and deamination.

Expert Solution

Summary Introduction

6.

To determine:

The item that describes “the sequence AACGTCACACACATCG is changed to AACGTCACATCG”.

1. an A-T base pair in the wild-type gene is changed to a G-C pair.

2. an A-T base pair is changed to a T-A pair.

3. the sequence AAGCTTATCG is changed to AAGCTATCG.

4. the sequence CAGCAGCAGCAGCAGCAG is changed to CAGCAGCAGCAGCAGCAGCAG.

5. the sequence AACGTTATCG is changed to AATGTTATCG.

6. the sequence AACGTCACACACATCG is changed to AACGTCACATCG.

7. the sequence AAGCTTATCG is changed to AAGCTTTATCG.

Introduction:

Crossing over is the process of exchange of genetic material between the sister chromatids at chiasmata.

Answer to Problem 1P

Correct answer:

The sequence AACGTCACACACATCG is changed to AACGTCACATCG: deletion and crossing over.

Explanation of Solution

In the given mutation, it can be noticed that a segment CACACACA has been lost from wild type sequence, so it is representing deletion. A segment can be removed from the wild type gene during the process of crossing over. Thus, the correct match for the given mutation is deletion and crossing over.

Expert Solution

Summary Introduction

7.

To determine:

The item that describes “the sequence AAGCTTATCG is changed to AAGCTTTATCG”.

1. an A-T base pair in the wild-type gene is changed to a G-C pair.

2. an A-T base pair is changed to a T-A pair.

3. the sequence AAGCTTATCG is changed to AAGCTATCG.

4. the sequence CAGCAGCAGCAGCAGCAG is changed to CAGCAGCAGCAGCAGCAGCAG.

5. the sequence AACGTTATCG is changed to AATGTTATCG.

6. the sequence AACGTCACACACATCG is changed to AACGTCACATCG.

7. the sequence AAGCTTATCG is changed to AAGCTTTATCG.

Introduction:

When one or more nitrogenous bases are removed from the nucleotide sequence, then the process is called deletion.

Answer to Problem 1P

Correct answer:

the sequence AAGCTTATCG is changed to AAGCTTTATCG: deletion and X-ray irradiation.

Explanation of Solution

Observation of wild type and mutated sequence can lead to a conclusion that there is a deletion of nitrogenous base T from wild type sequence. Deletion mutation may happen to because of exposure to X-ray irradiation. Thus, the correct match for the given mutation is deletion and X-ray irradiation.

Want to see more full solutions like this?

Subscribe now to access step-by-step solutions to millions of textbook problems written by subject matter experts!

Answer 5

Textbook Question

Answer 6

Textbook Question

Answer 7

Expert Solution

Summary Introduction

1.

To determine:

The item that describes “an A-T base pair in the wild-type gene is changed to a G-C pair.”

1. an A-T base pair in the wild-type gene is changed to a G-C pair.

2. an A-T base pair is changed to a T-A pair.

3. the sequence AAGCTTATCG is changed to AAGCTATCG.

4. the sequence CAGCAGCAGCAGCAGCAG is changed to CAGCAGCAGCAGCAGCAGCAG.

5. the sequence AACGTTATCG is changed to AATGTTATCG.

6. the sequence AACGTCACACACATCG is changed to AACGTCACATCG.

7. the sequence AAGCTTATCG is changed to AAGCTTTATCG.

Introduction:

When purines and pyrimidines are exchanged with each other, the process is called transition.

Answer to Problem 1P

Correct answer:

An A-T base pair in the wild-type gene is changed to a G-C pair: transition and base substitution.

Explanation of Solution

In the given mutation, A-T base pair is exchanged with a G-C base pair so it can be a base substitution. This can also be a transition mutation because adenine is a purine which is interchanged with another purine that is guanine. Thymine replaced the cytosine, and both are also pyrimidines. Thus, this condition can be a base substitution mutation or a transition mutation.

Expert Solution

Summary Introduction

2.

To determine:

The item that describes “an A-T base pair is changed to a T-A pair”.

1. an A-T base pair in the wild-type gene is changed to a G-C pair.

2. an A-T base pair is changed to a T-A pair.

3. the sequence AAGCTTATCG is changed to AAGCTATCG.

4. the sequence CAGCAGCAGCAGCAGCAG is changed to CAGCAGCAGCAGCAGCAGCAG.

5. the sequence AACGTTATCG is changed to AATGTTATCG.

6. the sequence AACGTCACACACATCG is changed to AACGTCACATCG.

7. the sequence AAGCTTATCG is changed to AAGCTTTATCG.

Introduction:

When one purine is replaced by pyrimidine in a pair of two bases, the resulting process is called transversion.

Answer to Problem 1P

Correct answer:

an A-T base pair is changed to a T-A pair: base substitution and transversion.

Explanation of Solution

In the given mutation, a base pair ‘A-T’ can be changed to a ‘T-A’ base-pair so the replacement of one purine with pyrimidine can be observed. Thus, the mutation for concerting A-T into T-A can be a transversion. The substitution of A by T is taking place so, it can also be a base substitution mutation.

Expert Solution

Summary Introduction

3.

To determine:

The item that describes “the sequence AAGCTTATCG is changed to AAGCTATCG”.

1. an A-T base pair in the wild-type gene is changed to a G-C pair.

2. an A-T base pair is changed to a T-A pair.

3. the sequence AAGCTTATCG is changed to AAGCTATCG.

4. the sequence CAGCAGCAGCAGCAGCAG is changed to CAGCAGCAGCAGCAGCAGCAG.

5. the sequence AACGTTATCG is changed to AATGTTATCG.

6. the sequence AACGTCACACACATCG is changed to AACGTCACATCG.

7. the sequence AAGCTTATCG is changed to AAGCTTTATCG.

Introduction:

In this particular case, the exposure of X-rays is responsible for deletion mutation from the wild type sequence.

Answer to Problem 1P

Correct answer:

the sequence AAGCTTATCG is changed to AAGCTATCG: deletion and X-ray irradiation.

Explanation of Solution

If both, wild type and mutated sequence are observed that it can be seen that there is a deletion of nitrogenous base T from wild type sequence. The exposure to X-ray irradiation may be responsible for deletion mutation. Thus, the correct match for the given mutation is deletion and X-ray irradiation.

Expert Solution

Summary Introduction

4.

To determine:

The item that describes “the sequence CAGCAGCAGCAGCAGCAG is changed to CAGCAGCAGCAGCAGCAGCAG”.

1. an A-T base pair in the wild-type gene is changed to a G-C pair.

2. an A-T base pair is changed to a T-A pair.

3. the sequence AAGCTTATCG is changed to AAGCTATCG.

4. the sequence CAGCAGCAGCAGCAGCAG is changed to CAGCAGCAGCAGCAGCAGCAG.

5. the sequence AACGTTATCG is changed to AATGTTATCG.

6. the sequence AACGTCACACACATCG is changed to AACGTCACATCG.

7. the sequence AAGCTTATCG is changed to AAGCTTTATCG.

Introduction:

When one or more nitrogenous bases are added to a specific sequence of nucleotides, then the process of insertion takes place.

Answer to Problem 1P

Correct answer:

The sequence CAGCAGCAGCAGCAGCAG is changed to CAGCAGCAGCAGCAGCAGCAG: insertion and intercalator.

Explanation of Solution

Insertion is a mutation in which a nitrogenous base or a group of the nitrogenous bases are added to a sequence. In the given mutation, a thymine residue is added to the wild type sequence for mutation. Thus, the kind of mutation is an insertion, and it can result from the introduction of some chemical mutagens like ethidium bromide. These chemical mutagens are intercalated with sequence and are known as intercalators. Thus, the correct match for the given mutation is insertion and intercalator.

Expert Solution

Summary Introduction

5.

To determine:

The item that describes “the sequence AACGTTATCG is changed to AATGTTATCG”.

1. an A-T base pair in the wild-type gene is changed to a G-C pair.

2. an A-T base pair is changed to a T-A pair.

3. the sequence AAGCTTATCG is changed to AAGCTATCG.

4. the sequence CAGCAGCAGCAGCAGCAG is changed to CAGCAGCAGCAGCAGCAGCAG.

5. the sequence AACGTTATCG is changed to AATGTTATCG.

6. the sequence AACGTCACACACATCG is changed to AACGTCACATCG.

7. the sequence AAGCTTATCG is changed to AAGCTTTATCG.

Introduction:

Transition is the change of one purine to another purine or one pyrimidine to another pyrimidine.

Answer to Problem 1P

Correct answer:

the sequence AACGTTATCG is changed to AATGTTATCG: base substitution, transition, and deamination.

Explanation of Solution

In the given mutation, base T is exchanged with base C so it can be a base substitution. This can also be a transition mutation because cytosine is a pyrimidine which is interchanged with another pyrimidine that is thymine. Deamination can also be noticed in the given mutation because the conversion of a methylated C to T is taking place. Thus, the correct match for the given mutation is a substitution, transition, and deamination.

Expert Solution

Summary Introduction

6.

To determine:

The item that describes “the sequence AACGTCACACACATCG is changed to AACGTCACATCG”.

1. an A-T base pair in the wild-type gene is changed to a G-C pair.

2. an A-T base pair is changed to a T-A pair.

3. the sequence AAGCTTATCG is changed to AAGCTATCG.

4. the sequence CAGCAGCAGCAGCAGCAG is changed to CAGCAGCAGCAGCAGCAGCAG.

5. the sequence AACGTTATCG is changed to AATGTTATCG.

6. the sequence AACGTCACACACATCG is changed to AACGTCACATCG.

7. the sequence AAGCTTATCG is changed to AAGCTTTATCG.

Introduction:

Crossing over is the process of exchange of genetic material between the sister chromatids at chiasmata.

Answer to Problem 1P

Correct answer:

The sequence AACGTCACACACATCG is changed to AACGTCACATCG: deletion and crossing over.

Explanation of Solution

In the given mutation, it can be noticed that a segment CACACACA has been lost from wild type sequence, so it is representing deletion. A segment can be removed from the wild type gene during the process of crossing over. Thus, the correct match for the given mutation is deletion and crossing over.

Expert Solution

Summary Introduction

7.

To determine:

The item that describes “the sequence AAGCTTATCG is changed to AAGCTTTATCG”.

1. an A-T base pair in the wild-type gene is changed to a G-C pair.

2. an A-T base pair is changed to a T-A pair.

3. the sequence AAGCTTATCG is changed to AAGCTATCG.

4. the sequence CAGCAGCAGCAGCAGCAG is changed to CAGCAGCAGCAGCAGCAGCAG.

5. the sequence AACGTTATCG is changed to AATGTTATCG.

6. the sequence AACGTCACACACATCG is changed to AACGTCACATCG.

7. the sequence AAGCTTATCG is changed to AAGCTTTATCG.

Introduction:

When one or more nitrogenous bases are removed from the nucleotide sequence, then the process is called deletion.

Answer to Problem 1P

Correct answer:

the sequence AAGCTTATCG is changed to AAGCTTTATCG: deletion and X-ray irradiation.

Explanation of Solution

Observation of wild type and mutated sequence can lead to a conclusion that there is a deletion of nitrogenous base T from wild type sequence. Deletion mutation may happen to because of exposure to X-ray irradiation. Thus, the correct match for the given mutation is deletion and X-ray irradiation.

Answer 8

Expert Solution

Summary Introduction

1.

To determine:

The item that describes “an A-T base pair in the wild-type gene is changed to a G-C pair.”

1. an A-T base pair in the wild-type gene is changed to a G-C pair.

2. an A-T base pair is changed to a T-A pair.

3. the sequence AAGCTTATCG is changed to AAGCTATCG.

4. the sequence CAGCAGCAGCAGCAGCAG is changed to CAGCAGCAGCAGCAGCAGCAG.

5. the sequence AACGTTATCG is changed to AATGTTATCG.

6. the sequence AACGTCACACACATCG is changed to AACGTCACATCG.

7. the sequence AAGCTTATCG is changed to AAGCTTTATCG.

Introduction:

When purines and pyrimidines are exchanged with each other, the process is called transition.

Answer to Problem 1P

Correct answer:

An A-T base pair in the wild-type gene is changed to a G-C pair: transition and base substitution.

Explanation of Solution

In the given mutation, A-T base pair is exchanged with a G-C base pair so it can be a base substitution. This can also be a transition mutation because adenine is a purine which is interchanged with another purine that is guanine. Thymine replaced the cytosine, and both are also pyrimidines. Thus, this condition can be a base substitution mutation or a transition mutation.

Answer 9

Expert Solution

Answer 10

Expert Solution

Answer 11

Expert Solution

Answer 12

Summary Introduction

1.

To determine:

The item that describes “an A-T base pair in the wild-type gene is changed to a G-C pair.”

1. an A-T base pair in the wild-type gene is changed to a G-C pair.

2. an A-T base pair is changed to a T-A pair.

3. the sequence AAGCTTATCG is changed to AAGCTATCG.

4. the sequence CAGCAGCAGCAGCAGCAG is changed to CAGCAGCAGCAGCAGCAGCAG.

5. the sequence AACGTTATCG is changed to AATGTTATCG.

6. the sequence AACGTCACACACATCG is changed to AACGTCACATCG.

7. the sequence AAGCTTATCG is changed to AAGCTTTATCG.

Introduction:

When purines and pyrimidines are exchanged with each other, the process is called transition.

Answer 13

Answer to Problem 1P

Correct answer:

An A-T base pair in the wild-type gene is changed to a G-C pair: transition and base substitution.

Answer 14

Explanation of Solution

In the given mutation, A-T base pair is exchanged with a G-C base pair so it can be a base substitution. This can also be a transition mutation because adenine is a purine which is interchanged with another purine that is guanine. Thymine replaced the cytosine, and both are also pyrimidines. Thus, this condition can be a base substitution mutation or a transition mutation.

Answer 15

Expert Solution

Summary Introduction

2.

To determine:

The item that describes “an A-T base pair is changed to a T-A pair”.

1. an A-T base pair in the wild-type gene is changed to a G-C pair.

2. an A-T base pair is changed to a T-A pair.

3. the sequence AAGCTTATCG is changed to AAGCTATCG.

4. the sequence CAGCAGCAGCAGCAGCAG is changed to CAGCAGCAGCAGCAGCAGCAG.

5. the sequence AACGTTATCG is changed to AATGTTATCG.

6. the sequence AACGTCACACACATCG is changed to AACGTCACATCG.

7. the sequence AAGCTTATCG is changed to AAGCTTTATCG.

Introduction:

When one purine is replaced by pyrimidine in a pair of two bases, the resulting process is called transversion.

Answer to Problem 1P

Correct answer:

an A-T base pair is changed to a T-A pair: base substitution and transversion.

Explanation of Solution

In the given mutation, a base pair ‘A-T’ can be changed to a ‘T-A’ base-pair so the replacement of one purine with pyrimidine can be observed. Thus, the mutation for concerting A-T into T-A can be a transversion. The substitution of A by T is taking place so, it can also be a base substitution mutation.

Answer 16

Expert Solution

Answer 17

Expert Solution

Answer 18

Expert Solution

Answer 19

Summary Introduction

2.

To determine:

The item that describes “an A-T base pair is changed to a T-A pair”.

1. an A-T base pair in the wild-type gene is changed to a G-C pair.

2. an A-T base pair is changed to a T-A pair.

3. the sequence AAGCTTATCG is changed to AAGCTATCG.

4. the sequence CAGCAGCAGCAGCAGCAG is changed to CAGCAGCAGCAGCAGCAGCAG.

5. the sequence AACGTTATCG is changed to AATGTTATCG.

6. the sequence AACGTCACACACATCG is changed to AACGTCACATCG.

7. the sequence AAGCTTATCG is changed to AAGCTTTATCG.

Introduction:

When one purine is replaced by pyrimidine in a pair of two bases, the resulting process is called transversion.

Answer 20

Answer to Problem 1P

Correct answer:

an A-T base pair is changed to a T-A pair: base substitution and transversion.

Answer 21

Explanation of Solution

In the given mutation, a base pair ‘A-T’ can be changed to a ‘T-A’ base-pair so the replacement of one purine with pyrimidine can be observed. Thus, the mutation for concerting A-T into T-A can be a transversion. The substitution of A by T is taking place so, it can also be a base substitution mutation.

Answer 22

Expert Solution

Summary Introduction

3.

To determine:

The item that describes “the sequence AAGCTTATCG is changed to AAGCTATCG”.

1. an A-T base pair in the wild-type gene is changed to a G-C pair.

2. an A-T base pair is changed to a T-A pair.

3. the sequence AAGCTTATCG is changed to AAGCTATCG.

4. the sequence CAGCAGCAGCAGCAGCAG is changed to CAGCAGCAGCAGCAGCAGCAG.

5. the sequence AACGTTATCG is changed to AATGTTATCG.

6. the sequence AACGTCACACACATCG is changed to AACGTCACATCG.

7. the sequence AAGCTTATCG is changed to AAGCTTTATCG.

Introduction:

In this particular case, the exposure of X-rays is responsible for deletion mutation from the wild type sequence.

Answer to Problem 1P

Correct answer:

the sequence AAGCTTATCG is changed to AAGCTATCG: deletion and X-ray irradiation.

Explanation of Solution

If both, wild type and mutated sequence are observed that it can be seen that there is a deletion of nitrogenous base T from wild type sequence. The exposure to X-ray irradiation may be responsible for deletion mutation. Thus, the correct match for the given mutation is deletion and X-ray irradiation.

Answer 23

Expert Solution

Answer 24

Expert Solution

Answer 25

Expert Solution

Answer 26

Summary Introduction

3.

To determine:

The item that describes “the sequence AAGCTTATCG is changed to AAGCTATCG”.

1. an A-T base pair in the wild-type gene is changed to a G-C pair.

2. an A-T base pair is changed to a T-A pair.

3. the sequence AAGCTTATCG is changed to AAGCTATCG.

4. the sequence CAGCAGCAGCAGCAGCAG is changed to CAGCAGCAGCAGCAGCAGCAG.

5. the sequence AACGTTATCG is changed to AATGTTATCG.

6. the sequence AACGTCACACACATCG is changed to AACGTCACATCG.

7. the sequence AAGCTTATCG is changed to AAGCTTTATCG.

Introduction:

In this particular case, the exposure of X-rays is responsible for deletion mutation from the wild type sequence.

Answer 27

Answer to Problem 1P

Correct answer:

the sequence AAGCTTATCG is changed to AAGCTATCG: deletion and X-ray irradiation.

Answer 28

Explanation of Solution

If both, wild type and mutated sequence are observed that it can be seen that there is a deletion of nitrogenous base T from wild type sequence. The exposure to X-ray irradiation may be responsible for deletion mutation. Thus, the correct match for the given mutation is deletion and X-ray irradiation.

Answer 29

Expert Solution

Summary Introduction

4.

To determine:

The item that describes “the sequence CAGCAGCAGCAGCAGCAG is changed to CAGCAGCAGCAGCAGCAGCAG”.

1. an A-T base pair in the wild-type gene is changed to a G-C pair.

2. an A-T base pair is changed to a T-A pair.

3. the sequence AAGCTTATCG is changed to AAGCTATCG.

4. the sequence CAGCAGCAGCAGCAGCAG is changed to CAGCAGCAGCAGCAGCAGCAG.

5. the sequence AACGTTATCG is changed to AATGTTATCG.

6. the sequence AACGTCACACACATCG is changed to AACGTCACATCG.

7. the sequence AAGCTTATCG is changed to AAGCTTTATCG.

Introduction:

When one or more nitrogenous bases are added to a specific sequence of nucleotides, then the process of insertion takes place.

Answer to Problem 1P

Correct answer:

The sequence CAGCAGCAGCAGCAGCAG is changed to CAGCAGCAGCAGCAGCAGCAG: insertion and intercalator.

Explanation of Solution

Insertion is a mutation in which a nitrogenous base or a group of the nitrogenous bases are added to a sequence. In the given mutation, a thymine residue is added to the wild type sequence for mutation. Thus, the kind of mutation is an insertion, and it can result from the introduction of some chemical mutagens like ethidium bromide. These chemical mutagens are intercalated with sequence and are known as intercalators. Thus, the correct match for the given mutation is insertion and intercalator.

Answer 30

Expert Solution

Answer 31

Expert Solution

Answer 32

Expert Solution

Answer 33

Summary Introduction

4.

To determine:

The item that describes “the sequence CAGCAGCAGCAGCAGCAG is changed to CAGCAGCAGCAGCAGCAGCAG”.

1. an A-T base pair in the wild-type gene is changed to a G-C pair.

2. an A-T base pair is changed to a T-A pair.

3. the sequence AAGCTTATCG is changed to AAGCTATCG.

4. the sequence CAGCAGCAGCAGCAGCAG is changed to CAGCAGCAGCAGCAGCAGCAG.

5. the sequence AACGTTATCG is changed to AATGTTATCG.

6. the sequence AACGTCACACACATCG is changed to AACGTCACATCG.

7. the sequence AAGCTTATCG is changed to AAGCTTTATCG.

Introduction:

When one or more nitrogenous bases are added to a specific sequence of nucleotides, then the process of insertion takes place.

Answer 34

Answer to Problem 1P

Correct answer:

The sequence CAGCAGCAGCAGCAGCAG is changed to CAGCAGCAGCAGCAGCAGCAG: insertion and intercalator.

Answer 35

Explanation of Solution

Insertion is a mutation in which a nitrogenous base or a group of the nitrogenous bases are added to a sequence. In the given mutation, a thymine residue is added to the wild type sequence for mutation. Thus, the kind of mutation is an insertion, and it can result from the introduction of some chemical mutagens like ethidium bromide. These chemical mutagens are intercalated with sequence and are known as intercalators. Thus, the correct match for the given mutation is insertion and intercalator.

Answer 36

Expert Solution

Summary Introduction

5.

To determine:

The item that describes “the sequence AACGTTATCG is changed to AATGTTATCG”.

1. an A-T base pair in the wild-type gene is changed to a G-C pair.

2. an A-T base pair is changed to a T-A pair.

3. the sequence AAGCTTATCG is changed to AAGCTATCG.

4. the sequence CAGCAGCAGCAGCAGCAG is changed to CAGCAGCAGCAGCAGCAGCAG.

5. the sequence AACGTTATCG is changed to AATGTTATCG.

6. the sequence AACGTCACACACATCG is changed to AACGTCACATCG.

7. the sequence AAGCTTATCG is changed to AAGCTTTATCG.

Introduction:

Transition is the change of one purine to another purine or one pyrimidine to another pyrimidine.

Answer to Problem 1P

Correct answer:

the sequence AACGTTATCG is changed to AATGTTATCG: base substitution, transition, and deamination.

Explanation of Solution

In the given mutation, base T is exchanged with base C so it can be a base substitution. This can also be a transition mutation because cytosine is a pyrimidine which is interchanged with another pyrimidine that is thymine. Deamination can also be noticed in the given mutation because the conversion of a methylated C to T is taking place. Thus, the correct match for the given mutation is a substitution, transition, and deamination.

Answer 37

Expert Solution

Answer 38

Expert Solution

Answer 39

Expert Solution

Answer 40

Summary Introduction

5.

To determine:

The item that describes “the sequence AACGTTATCG is changed to AATGTTATCG”.

1. an A-T base pair in the wild-type gene is changed to a G-C pair.

2. an A-T base pair is changed to a T-A pair.

3. the sequence AAGCTTATCG is changed to AAGCTATCG.

4. the sequence CAGCAGCAGCAGCAGCAG is changed to CAGCAGCAGCAGCAGCAGCAG.

5. the sequence AACGTTATCG is changed to AATGTTATCG.

6. the sequence AACGTCACACACATCG is changed to AACGTCACATCG.

7. the sequence AAGCTTATCG is changed to AAGCTTTATCG.

Introduction:

Transition is the change of one purine to another purine or one pyrimidine to another pyrimidine.

Answer 41

Answer to Problem 1P

Correct answer:

the sequence AACGTTATCG is changed to AATGTTATCG: base substitution, transition, and deamination.

Answer 42

Explanation of Solution

In the given mutation, base T is exchanged with base C so it can be a base substitution. This can also be a transition mutation because cytosine is a pyrimidine which is interchanged with another pyrimidine that is thymine. Deamination can also be noticed in the given mutation because the conversion of a methylated C to T is taking place. Thus, the correct match for the given mutation is a substitution, transition, and deamination.

Answer 43

Expert Solution

Summary Introduction

6.

To determine:

The item that describes “the sequence AACGTCACACACATCG is changed to AACGTCACATCG”.

1. an A-T base pair in the wild-type gene is changed to a G-C pair.

2. an A-T base pair is changed to a T-A pair.

3. the sequence AAGCTTATCG is changed to AAGCTATCG.

4. the sequence CAGCAGCAGCAGCAGCAG is changed to CAGCAGCAGCAGCAGCAGCAG.

5. the sequence AACGTTATCG is changed to AATGTTATCG.

6. the sequence AACGTCACACACATCG is changed to AACGTCACATCG.

7. the sequence AAGCTTATCG is changed to AAGCTTTATCG.

Introduction:

Crossing over is the process of exchange of genetic material between the sister chromatids at chiasmata.

Answer to Problem 1P

Correct answer:

The sequence AACGTCACACACATCG is changed to AACGTCACATCG: deletion and crossing over.

Explanation of Solution

In the given mutation, it can be noticed that a segment CACACACA has been lost from wild type sequence, so it is representing deletion. A segment can be removed from the wild type gene during the process of crossing over. Thus, the correct match for the given mutation is deletion and crossing over.

Answer 44

Expert Solution

Answer 45

Expert Solution

Answer 46

Expert Solution

Answer 47

Summary Introduction

6.

To determine:

The item that describes “the sequence AACGTCACACACATCG is changed to AACGTCACATCG”.

1. an A-T base pair in the wild-type gene is changed to a G-C pair.

2. an A-T base pair is changed to a T-A pair.

3. the sequence AAGCTTATCG is changed to AAGCTATCG.

4. the sequence CAGCAGCAGCAGCAGCAG is changed to CAGCAGCAGCAGCAGCAGCAG.

5. the sequence AACGTTATCG is changed to AATGTTATCG.

6. the sequence AACGTCACACACATCG is changed to AACGTCACATCG.

7. the sequence AAGCTTATCG is changed to AAGCTTTATCG.

Introduction:

Crossing over is the process of exchange of genetic material between the sister chromatids at chiasmata.

Answer 48

Answer to Problem 1P

Correct answer:

The sequence AACGTCACACACATCG is changed to AACGTCACATCG: deletion and crossing over.

Answer 49

Explanation of Solution

In the given mutation, it can be noticed that a segment CACACACA has been lost from wild type sequence, so it is representing deletion. A segment can be removed from the wild type gene during the process of crossing over. Thus, the correct match for the given mutation is deletion and crossing over.

Answer 50

Expert Solution

Summary Introduction

7.

To determine:

The item that describes “the sequence AAGCTTATCG is changed to AAGCTTTATCG”.

1. an A-T base pair in the wild-type gene is changed to a G-C pair.

2. an A-T base pair is changed to a T-A pair.

3. the sequence AAGCTTATCG is changed to AAGCTATCG.

4. the sequence CAGCAGCAGCAGCAGCAG is changed to CAGCAGCAGCAGCAGCAGCAG.

5. the sequence AACGTTATCG is changed to AATGTTATCG.

6. the sequence AACGTCACACACATCG is changed to AACGTCACATCG.

7. the sequence AAGCTTATCG is changed to AAGCTTTATCG.

Introduction:

When one or more nitrogenous bases are removed from the nucleotide sequence, then the process is called deletion.

Answer to Problem 1P

Correct answer:

the sequence AAGCTTATCG is changed to AAGCTTTATCG: deletion and X-ray irradiation.

Explanation of Solution

Observation of wild type and mutated sequence can lead to a conclusion that there is a deletion of nitrogenous base T from wild type sequence. Deletion mutation may happen to because of exposure to X-ray irradiation. Thus, the correct match for the given mutation is deletion and X-ray irradiation.

Answer 51

Expert Solution

Answer 52

Expert Solution

Answer 53

Expert Solution

Answer 54

Summary Introduction

7.

To determine:

The item that describes “the sequence AAGCTTATCG is changed to AAGCTTTATCG”.

1. an A-T base pair in the wild-type gene is changed to a G-C pair.

2. an A-T base pair is changed to a T-A pair.

3. the sequence AAGCTTATCG is changed to AAGCTATCG.

4. the sequence CAGCAGCAGCAGCAGCAG is changed to CAGCAGCAGCAGCAGCAGCAG.

5. the sequence AACGTTATCG is changed to AATGTTATCG.

6. the sequence AACGTCACACACATCG is changed to AACGTCACATCG.

7. the sequence AAGCTTATCG is changed to AAGCTTTATCG.

Introduction:

When one or more nitrogenous bases are removed from the nucleotide sequence, then the process is called deletion.

Answer 55

Answer to Problem 1P

Correct answer:

the sequence AAGCTTATCG is changed to AAGCTTTATCG: deletion and X-ray irradiation.

Answer 56

Explanation of Solution

Observation of wild type and mutated sequence can lead to a conclusion that there is a deletion of nitrogenous base T from wild type sequence. Deletion mutation may happen to because of exposure to X-ray irradiation. Thus, the correct match for the given mutation is deletion and X-ray irradiation.