
_____ 1. Which bone is formed from intramembranous bone growth?
- a. femur
- b. rib
- c. os coxae (hip bone)
- d. frontal bone

Introduction:
The process of formation and development of bone inside the mesenchyme is called intramembranous ossification. The mesenchyme has an abundance of ground tissue and mesenchymal cells.
Answer to Problem 1DYKB
Correct answer:
The intramembranous ossification leads to the growth of frontal bone. Therefore, option d . is correct.
Explanation of Solution
Reason for the correct statement:
The intramembranous ossification got initiated with the thickening and condensation of the mesenchyme along with a good supply of blood through capillaries. The formation of ossification centers starts in the dense regions of mesenchyme during the development. The spongy and compact bones are formed in layers forming the flat bones. The frontal bone is one of the flat bones of the skull. Hence, the frontal bone is developed from “intramembranous ossification”.
Option d. is given as “frontal bone”.
Hence, option d. is correct.
Reasons for incorrect statements:
Option a. is given as “femur”.
The process, by which most of the bones are produced by hyaline cartilage, is called “endochondral ossification”. The formation and development of femur bone occur by the process of endochondral ossification. Hence, option a. is incorrect.
Option b. is given as “rib”.
The formation and development of rib bone occur by the process of endochondral ossification. Hence, option b. is incorrect.
Option c. is given as “os coxae (hip bone)”.
The formation and development of hip bone occur by the process of endochondral ossification. Hence, option c. is incorrect.
Hence, options a., b., and c. are incorrect.
The flat bones are formed by intramembranous ossification. The frontal bone of skull is one of the flat bones.
Want to see more full solutions like this?
Chapter 7 Solutions
Anatomy & Physiology: An Integrative Approach
- series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forward
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
- Medical Terminology for Health Professions, Spira...Health & NutritionISBN:9781305634350Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. SchroederPublisher:Cengage Learning
- Comprehensive Medical Assisting: Administrative a...NursingISBN:9781305964792Author:Wilburta Q. Lindh, Carol D. Tamparo, Barbara M. Dahl, Julie Morris, Cindy CorreaPublisher:Cengage LearningBasic Clinical Lab Competencies for Respiratory C...NursingISBN:9781285244662Author:WhitePublisher:Cengage

