Human Anatomy Laboratory Manual With Cat Dissections (9th Edition)
9th Edition
ISBN: 9780135168035
Author: Elaine N. Marieb, Lori A. Smith
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Videos
Textbook Question
Chapter 7, Problem 17RQ
Describe the important features of the sternum.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Biology
You’re going to analyze 5 ul of your PCR product(out of 50 ul) on the gel. How much of 6X DNAloading buffer (dye) are you going to mix with yourPCR product to make final 1X concentration ofloading buffer in the PCR product-loading buffermixture?
Write the assignment on the title "GYMNOSPERMS" focus on the explanation of its important families, characters and reproduction.
Awnser these
Discussion Questions
Answer these discussion questions and submit them as part of your lab report.
Part A: The Effect of Temperature on Enzyme Activity
Graph the volume of oxygen produced against the temperature of the solution.
How is the oxygen production in 30 seconds related to the rate of the reaction?
At what temperature is the rate of reaction the highest? Lowest? Explain.
Why might the enzyme activity decrease at very high temperatures?
Why might a high fever be dangerous to humans?
What is the optimal temperature for enzymes in the human body?
Part B: The Effect of pH on Enzyme Activity
Graph the volume of oxygen produced against the pH of the solution.
At what pH is the rate of reaction the highest? Lowest? Explain.
Why does changing the pH affect the enzyme activity?
Research the enzyme catalase. What is its function in the human body?
What is the optimal pH for the following enzymes found in the human body? Explain. (catalase, lipase (in your stomach),…
Chapter 7 Solutions
Human Anatomy Laboratory Manual With Cat Dissections (9th Edition)
Ch. 7 - Name the bones that form the anterior cranial...Ch. 7 - For each feature listed, name the bone that...Ch. 7 - Which four bones articulate with the left parietal...Ch. 7 - Name all the bones that articulate with the...Ch. 7 - Which bones or bony processes form the hard...Ch. 7 - What are the alveolar processes, and on which...Ch. 7 - Which bones form the nasal conchae? What is the...Ch. 7 - Which of the bones that form the orbit are cranial...Ch. 7 - Which paranasal sinuses are located along the...Ch. 7 - Which portion of the intervertebral disc expands...
Ch. 7 - When and how do the secondary curvatures of the...Ch. 7 - Why do intervertebral discs usually herniate in...Ch. 7 - What does the superior articular process of a...Ch. 7 - Name one feature that is unique for all cervical...Ch. 7 - How can you distinguish thoracic vertebra T12 from...Ch. 7 - What part of the vertebrae form the median sacral...Ch. 7 - Define the sternal angle. Which rib articulates...Ch. 7 - What specific features of the thoracic vertebrae...Ch. 7 - Which skull bones form as two individual bones...Ch. 7 - Which abnormal spinal curvature is associated with...Ch. 7 - Match bones in column B to descriptions in column...Ch. 7 - Herniated intervertebral discs tend to herniate...Ch. 7 - The parts of the sternum that articulate at the...Ch. 7 - The only rib whose shaft is flattened in the...Ch. 7 - The name of the first cervical vertebra is ta)...Ch. 7 - Match the vertebrae listed in column B with the...Ch. 7 - Match the foramen in column B with the bone in...Ch. 7 - In the fetus, how do the relative proportions of...Ch. 7 - Name and diagram the four normal vertebral...Ch. 7 - List two specific structural characteristics each...Ch. 7 - Prob. 11RQCh. 7 - Is a floating rib a true rib or a false rib?...Ch. 7 - Briefly describe the anatomical characteristics...Ch. 7 - Compare the skeleton of a young adult to that of...Ch. 7 - Identify what types of movement are allowed by the...Ch. 7 - List the bones in each of the three cranial...Ch. 7 - Describe the important features of the sternum.Ch. 7 - Define the following structures in a way that...Ch. 7 - Describe where the four major fontanelles are...Ch. 7 - Professor Ron Singer pointed to the foramen magnum...Ch. 7 - In your anatomy course, you may be handed an...Ch. 7 - Describe how a typical true rib (for instance, the...Ch. 7 - Antonio was hit in the face with a bad-hop...Ch. 7 - Lindsey had polio as a child and was partially...Ch. 7 - Mr. Chester, a heavy beer drinker with a large...Ch. 7 - Which region of the vertebral column (cervical,...Ch. 7 - After falling off a horse, Mary complained of pain...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Anwser these Discussion Questions: Part One Why were the plants kept in the dark prior to the experiment? Why is this important? Why is it important to boil the leaf? Explain why it was necessary to use boiling alcohol? What is the purpose of the iodine? Part Two What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out? What conclusions can you draw from this part of the lab? Part Three 7. In this experiment what was the purpose of adding the soda lime? 8. Why was a sealed bag placed around each plant? 9. What happened in the control plants? 10. What was the result on photosynthesis? Part Four 11. Why was a variegated leaf used in this experiment? !2. What conclusions can you draw about starch production in a variegated leaf?arrow_forwardHow did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forward
- What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forward
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Anatomy & PhysiologyBiologyISBN:9781938168130Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark WomblePublisher:OpenStax College
Fundamentals of Sectional Anatomy: An Imaging App...BiologyISBN:9781133960867Author:Denise L. LazoPublisher:Cengage Learning
Medical Terminology for Health Professions, Spira...Health & NutritionISBN:9781305634350Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. SchroederPublisher:Cengage LearningBasic Clinical Lab Competencies for Respiratory C...NursingISBN:9781285244662Author:WhitePublisher:Cengage
Anatomy & Physiology
Biology
ISBN:9781938168130
Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble
Publisher:OpenStax College
Fundamentals of Sectional Anatomy: An Imaging App...
Biology
ISBN:9781133960867
Author:Denise L. Lazo
Publisher:Cengage Learning
Medical Terminology for Health Professions, Spira...
Health & Nutrition
ISBN:9781305634350
Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. Schroeder
Publisher:Cengage Learning
Basic Clinical Lab Competencies for Respiratory C...
Nursing
ISBN:9781285244662
Author:White
Publisher:Cengage
The Skeletal System; Author: Professor Dave Explains;https://www.youtube.com/watch?v=f-FF7Qigd3U;License: Standard YouTube License, CC-BY