Anatomy & Physiology
3rd Edition
ISBN: 9781259398629
Author: McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher: Mcgraw Hill Education,
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 6.1, Problem 4WDL
Summary Introduction
To determine:
What is the function of friction ridge.
Concept introduction:
The skin is the outer part of the body. It serves as the most important organ of the Integumentary system. The outer layer of skin is called epidermis which consists of seven layers. It helps to protect the bone, tissues, ligaments, muscle, and tendons.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Write the assignment on the title "GYMNOSPERMS" focus on the explanation of its important families, characters and reproduction.
Awnser these
Discussion Questions
Answer these discussion questions and submit them as part of your lab report.
Part A: The Effect of Temperature on Enzyme Activity
Graph the volume of oxygen produced against the temperature of the solution.
How is the oxygen production in 30 seconds related to the rate of the reaction?
At what temperature is the rate of reaction the highest? Lowest? Explain.
Why might the enzyme activity decrease at very high temperatures?
Why might a high fever be dangerous to humans?
What is the optimal temperature for enzymes in the human body?
Part B: The Effect of pH on Enzyme Activity
Graph the volume of oxygen produced against the pH of the solution.
At what pH is the rate of reaction the highest? Lowest? Explain.
Why does changing the pH affect the enzyme activity?
Research the enzyme catalase. What is its function in the human body?
What is the optimal pH for the following enzymes found in the human body? Explain. (catalase, lipase (in your stomach),…
Anwser these
Discussion Questions:
Part One
Why were the plants kept in the dark prior to the experiment? Why is this important?
Why is it important to boil the leaf?
Explain why it was necessary to use boiling alcohol?
What is the purpose of the iodine?
Part Two
What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out?
What conclusions can you draw from this part of the lab?
Part Three
7. In this experiment what was the purpose of adding the soda lime?
8. Why was a sealed bag placed around each plant?
9. What happened in the control plants?
10. What was the result on photosynthesis?
Part Four
11. Why was a variegated leaf used in this experiment?
!2. What conclusions can you draw about starch production in a variegated leaf?
Chapter 6 Solutions
Anatomy & Physiology
Ch. 6.1 - LEARNING OBJECTIVE
1. Describe the five layers...Ch. 6.1 - LEARNING OBJECTIVE
2. Differentiate between thick...Ch. 6.1 - Prob. 3LOCh. 6.1 - WHAT DO YOU THINK?
1 Why do you think thick skin...Ch. 6.1 - As you trim your roses, a thorn penetrates your...Ch. 6.1 - Briefly describe the process of keratinization....Ch. 6.1 - Prob. 3WDLCh. 6.1 - Prob. 4WDLCh. 6.1 - Prob. 4LOCh. 6.1 - Prob. 5LO
Ch. 6.1 - Prob. 6LOCh. 6.1 - Compare and contrast the papillary versus...Ch. 6.1 - What is indicated by the lines of cleavage in the...Ch. 6.1 - Prob. 7LOCh. 6.1 - What types of tissue form the subcutaneous layer?Ch. 6.1 - Prob. 8LOCh. 6.1 - Prob. 9LOCh. 6.1 - Prob. 10LOCh. 6.1 - Prob. 11LOCh. 6.1 - Prob. 12LOCh. 6.1 - Prob. 13LOCh. 6.1 - WHAT DO YOU THINK?
2 During the Industrial...Ch. 6.1 - How does the skin produce vitamin D?Ch. 6.1 - Is the skin entirely waterproof? Explain.Ch. 6.1 - Prob. 10WDLCh. 6.2 - Prob. 14LOCh. 6.2 - Prob. 15LOCh. 6.2 - What is the difference between the eponychium and...Ch. 6.2 - Prob. 16LOCh. 6.2 - Prob. 17LOCh. 6.2 - What are the three zones of a hair?Ch. 6.2 - How does hair function in protection and heat...Ch. 6.2 - Prob. 18LOCh. 6.2 - Prob. 19LOCh. 6.2 - Prob. 20LOCh. 6.2 - Prob. 3WDTCh. 6.2 - Prob. 14WDLCh. 6.2 - What do sebaceous glands secrete, and where is...Ch. 6.3 - Prob. 21LOCh. 6.3 - Prob. 22LOCh. 6.3 - What is granulation tissue, and when does it...Ch. 6.4 - LEARNING OBJECTIVES
23. Describe how integument...Ch. 6.4 - Prob. 24LOCh. 6.4 - What two primary germ layers form the integument?Ch. 6.4 - Prob. 25LOCh. 6.4 - Prob. 26LOCh. 6.4 - How do UV rays contribute to skin aging?Ch. 6 - _____1. Which statement is false about sebaceous...Ch. 6 - _____ 2. The layer of the epidermis in which cells...Ch. 6 - _____ 3. The sweat glands that communicate with...Ch. 6 - _____ 4. Which of the following is not a function...Ch. 6 - Prob. 5DYBCh. 6 - Do You Know the Basics?
6. Which statement is...Ch. 6 - Prob. 7DYBCh. 6 - _____ 8. The cells in a hair follicle that are...Ch. 6 - Prob. 9DYBCh. 6 - Prob. 10DYBCh. 6 - Describe the composition of the layers of the...Ch. 6 - Prob. 12DYBCh. 6 - Describe the tissue type and structure of the two...Ch. 6 - Prob. 14DYBCh. 6 - Compare the structure and composition of the...Ch. 6 - Prob. 16DYBCh. 6 - Where are ceruminous glands located, and what do...Ch. 6 - Discuss the steps involved in wound repair of the...Ch. 6 - Prob. 19DYBCh. 6 - Prob. 20DYBCh. 6 - Prob. 1CALCh. 6 - Prob. 2CALCh. 6 - Prob. 3CALCh. 6 - Prob. 1CSLCh. 6 - Prob. 2CSLCh. 6 - At the age of 50, John noticed that one of the...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- How did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forward
- Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forwardWhat is amplification bias?arrow_forward
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Principles Of Radiographic Imaging: An Art And A ...Health & NutritionISBN:9781337711067Author:Richard R. Carlton, Arlene M. Adler, Vesna BalacPublisher:Cengage Learning
- Surgical Tech For Surgical Tech Pos CareHealth & NutritionISBN:9781337648868Author:AssociationPublisher:Cengage
Principles Of Radiographic Imaging: An Art And A ...
Health & Nutrition
ISBN:9781337711067
Author:Richard R. Carlton, Arlene M. Adler, Vesna Balac
Publisher:Cengage Learning
Surgical Tech For Surgical Tech Pos Care
Health & Nutrition
ISBN:9781337648868
Author:Association
Publisher:Cengage