To determine:
The relationship between energy and the basic characteristics of life.
Introduction:
The energy is defined as the capacity to perform a task. All the living organism/cells require energy to perform the basic functions of the life.

Explanation of Solution
Energy:
The sun is the major source of energy for organisms and the ecosystems. Producers use energy from sunlight to make food. Cells need energy in order to survive. This energy is used to perform functions such as growth, maintaining balance, repair, reproduction, movement, and defense. This means all living organisms must obtain and use energy to live.
There are seven metabolic functions which make difference between living organisms and non-living organisms.
- Respiration Respiration is the release of energy from food substances in all living cells. Living things break down food within their cells to release energy for normal metabolic activity.
- Nutrition Living things take in materials from their surroundings that they use for growth or to provide energy. Nutrition is the process by which organisms obtain energy and raw materials from nutrients such as proteins, carbohydrates, and fats.
- Excretion All living things excrete. As a result of the many
- Growth Growth is seen in all living things. It involves using food to produce new cells. The permanent increase in cell number and size is termed growth.
- Movements All living things follow a specific pattern of movement. This may be observable, such as animals that are able to walk, or less observable, such as tropism in plants. The movement may be so slow, that it is very difficult to see.
- Sensitivity All living things are able to sense and respond to stimuli around them such as light, temperature, water, gravity, and chemical substances.
- Reproductions All living organisms have the ability to produce progeny. Only living organisms possess all of these characteristics.
All living organisms share the basic properties of life that are energy, which categorizes them as living and non-living beings. Energy is needed for the function of movement and standard metabolism.
Want to see more full solutions like this?
Chapter 6 Solutions
EP INQUIRY INTO LIFE-CONNECT ACCESS
- Anwser these Discussion Questions: Part One Why were the plants kept in the dark prior to the experiment? Why is this important? Why is it important to boil the leaf? Explain why it was necessary to use boiling alcohol? What is the purpose of the iodine? Part Two What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out? What conclusions can you draw from this part of the lab? Part Three 7. In this experiment what was the purpose of adding the soda lime? 8. Why was a sealed bag placed around each plant? 9. What happened in the control plants? 10. What was the result on photosynthesis? Part Four 11. Why was a variegated leaf used in this experiment? !2. What conclusions can you draw about starch production in a variegated leaf?arrow_forwardHow did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forward
- What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forward
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education





