GENETICS(LL)-W/CONNECT >CUSTOM<
6th Edition
ISBN: 9781260571561
Author: HARTWELL
Publisher: MCG CUSTOM
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 6, Problem 28P
A DNA synthesizer is a machine that uses automated chemical synthesis to generate short, single strands of DNA of any given sequence. You have used the machine to synthesize the following three DNA molecules:
(DNA 1) | 5′ CTACTACGGATCGGG 3′ |
(DNA 2) | 5′ CCAGTCCCGATCCGT 3′ |
(DNA 3) | 5′ AGTAGCCAGTGGGGAAAAACCCCACTGG 3 |
Now you add the DNA molecules either singly or in combination to reaction tubes containing DNA polymerase, dATP, dCTP, dGTP, and dTTP in a buffered solution that allows DNA polymerase to function. For each of the reaction tubes, indicate whether DNA polymerase will synthesize any new DNA molecules, and if so, write the sequence(s) of any such DNAs.
a. | DNA 1 plus DNA 3 |
b. | DNA 2 plus DNA 3 |
c. | DNA 1 plus DNA 2 |
d. | DNA 3 only |
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Answer number seven do what it says.
Which of the following is the process that is "capable of destroying all forms of microbial life"?
Question 37 options:
Surgical scrub
Sterilization
Chemical removal
Mechanical removal
After you feel comfortable with your counting method and identifying cells in the various stages of mitosis, use the four images below of whitefish blastula to count the cells in each stage until you reach 100 total cells, recording your data below in Data Table 1. (You may not need to use all four images. Stop counting when you reach 100 total cells.)
After totaling the cells in each stage, calculate the percent of cells in each stage. (Divide total of stage by overall total of 100 and then multiply by 100 to obtain percentage.)
Data Table 1Stage Totals PercentInterphase Mitosis: Prophase Metaphase Anaphase Telophase Cytokinesis Totals 100 100%
To find the length of time whitefish blastula cells spend in each stage, multiply the percent (recorded as a decimal, in other words take the percent number and divide by 100) by 24 hours. (Example: If percent is 20%, then Time in Hours = .2 * 24 = 4.8) Record your data in Data…
Chapter 6 Solutions
GENETICS(LL)-W/CONNECT >CUSTOM<
Ch. 6 - Griffith, in his 1928 experiments, demonstrated...Ch. 6 - Griffith, in his 1928 experiments, demonstrated...Ch. 6 - During bacterial transformation, DNA that enters a...Ch. 6 - Nitrogen and carbon are more abundant in proteins...Ch. 6 - If 30 of the bases in human DNA are A, a what...Ch. 6 - Which of the following statements are true about...Ch. 6 - Imagine you have three test tubes containing...Ch. 6 - What information about the structure of DNA was...Ch. 6 - A portion of one DNA strand of the human gene...Ch. 6 - When a double-stranded DNA molecule is exposed to...
Ch. 6 - A particular virus with DNA as its genetic...Ch. 6 - The underlying structure of DNA is very simple,...Ch. 6 - Prob. 13PCh. 6 - Bacterial transformation and bacteriophage...Ch. 6 - The CAP protein is shown bound to DNA in Fig....Ch. 6 - In Meselson and Stahls density shift experiments...Ch. 6 - When Meselson and Stahl grew E. coli in 15N medium...Ch. 6 - If you expose human tissue culture cells for...Ch. 6 - Draw a replication bubble with both replication...Ch. 6 - a. Do any strands of nucleic acid exist in nature...Ch. 6 - As Fig. 6.21 shows, DNA polymerase cleaves the...Ch. 6 - The bases of one of the strands of DNA in a region...Ch. 6 - Replicating structures in DNA can be observed in...Ch. 6 - Indicate the role of each of the following in DNA...Ch. 6 - Draw a diagram of replication that is occurring at...Ch. 6 - Figure 6.18 depicts Watson and Cricks initial...Ch. 6 - Researchers have discovered that during...Ch. 6 - A DNA synthesizer is a machine that uses automated...Ch. 6 - Bacterial cells were coinfected with two types of...Ch. 6 - A yeast strain with a mutant spo11- allele has...Ch. 6 - Imagine that you have done a cross between two...Ch. 6 - The Neurospora octad shown came from a cross...Ch. 6 - From a cross between e f g and e f g strains of...Ch. 6 - In Step 6 of Fig. 6.27, the resolvase enzyme...Ch. 6 - Figure 6.31shows four potential outcomes of...Ch. 6 - Each of the substrates for site-specific...Ch. 6 - Prob. 37PCh. 6 - Suppose that you could inject a wild-type mouse...Ch. 6 - C31 is a type of bacteriophage that infects...Ch. 6 - Cre is a recombinase enzyme encoded by a gene in...Ch. 6 - Like Cre/loxP recombination, site-specific...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- What are Clathrin coated vesicles and what is their function?arrow_forwardHow is a protein destined for the Endoplasmic Reticulum (ER), imported into the ER? Be concise.arrow_forwardFind out about the organisations and the movements aimed at the conservation of our natural resources. Eg Chipko movement and Greenpeace. Make a project report on such an organisation.arrow_forward
- What are biofertilizers and mention the significancearrow_forwardPCBs and River Otters: Otters in Washington State’s Green-Duwamish River have high levels of polychlorinated biphenyls (PCBs) in their livers. PCBs can bind to the estrogen receptors in animals and disrupt the endocrine system of these otters. The PCBs seem to increase the estrogen to androgen ratio, skewing the ratio toward too much estrogen. How would increased estrogen affect the river otter population? Based on your reading of the materials in this unit, what factors can affect fertility in humans? Explain how each of the factors affecting human fertility that you described can disrupt the human endocrine system to affect reproduction.arrow_forwardOther than oil and alcohol, are there other liquids you could compare to water (that are liquid at room temperature)? How is water unique compared to these other liquids? What follow-up experiment would you like to do, and how would you relate it to your life?arrow_forward
- Selection of Traits What adaptations do scavengers have for locating and feeding on prey? What adaptations do predators have for capturing and consuming prey?arrow_forwardCompetition Between Species What natural processes limit populations from growing too large? What are some resources organisms can compete over in their natural habitat?arrow_forwardSpecies Interactions Explain how predators, prey and scavengers interact. Explain whether predators and scavengers are necessary or beneficial for an ecosystem.arrow_forward
- magine that you are conducting research on fruit type and seed dispersal. You submitted a paper to a peer-reviewed journal that addresses the factors that impact fruit type and seed dispersal mechanisms in plants of Central America. The editor of the journal communicates that your paper may be published if you make ‘minor revisions’ to the document. Describe two characteristics that you would expect in seeds that are dispersed by the wind. Contrast this with what you would expect for seeds that are gathered, buried or eaten by animals, and explain why they are different. (Editor’s note: Providing this information in your discussion will help readers to consider the significance of the research).arrow_forwardWhat is the difference between Uniporters, Symporters and Antiporters? Which of these are examples of active transport?arrow_forwardWhat are coupled transporters?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage LearningHuman Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage LearningBiology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage LearningConcepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax CollegeHuman Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College
Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning
Molecular Techniques: Basic Concepts; Author: Dr. A's Clinical Lab Videos;https://www.youtube.com/watch?v=7HFHZy8h6z0;License: Standard Youtube License