ND STONY BROOK UNIVERSITY LOOSELEAF GENETICS: FROM GENES TO GENOMES
6th Edition
ISBN: 9781260406092
Author: HARTWELL, Leland, HOOD, Leroy, Goldberg, Michael
Publisher: Mcgraw-hill Education/stony Brook University
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 6, Problem 28P
A DNA synthesizer is a machine that uses automated chemical synthesis to generate short, single strands of DNA of any given sequence. You have used the machine to synthesize the following three DNA molecules:
(DNA 1) | 5′ CTACTACGGATCGGG 3′ |
(DNA 2) | 5′ CCAGTCCCGATCCGT 3′ |
(DNA 3) | 5′ AGTAGCCAGTGGGGAAAAACCCCACTGG 3 |
Now you add the DNA molecules either singly or in combination to reaction tubes containing DNA polymerase, dATP, dCTP, dGTP, and dTTP in a buffered solution that allows DNA polymerase to function. For each of the reaction tubes, indicate whether DNA polymerase will synthesize any new DNA molecules, and if so, write the sequence(s) of any such DNAs.
a. | DNA 1 plus DNA 3 |
b. | DNA 2 plus DNA 3 |
c. | DNA 1 plus DNA 2 |
d. | DNA 3 only |
Expert Solution & Answer
![Check Mark](/static/check-mark.png)
Want to see the full answer?
Check out a sample textbook solution![Blurred answer](/static/blurred-answer.jpg)
Students have asked these similar questions
According to a recent study, 1 out of 50,000 people will be diagnosed with
cystic fibrosis. Cystic fibrosis can be caused by a mutant form of the CFTR gene
(dominant gene symbol is F and mutant is f).
A. Using the rate of incidence above, what is the frequency of carriers of the
cystic fibrosis allele for CFTR in the US? (3 pts)
B. In a clinical study, 400 people from the population mentioned in (A.) were
genotyped for BRCA1 Listed below are the results. Are these results in Hardy-
Weinberg equilibrium? Use Chi Square to show whether or not they are. (3 pts)
BRCA1 genotype
# of women
390
BB
Bb
bb
10
0
12pt
Paragraph
L
BIUAV V
T² v
V
Outline a method for using apomixis to maintain feminized CannabisAssume apomixis is controlled by a single dominant gene. You can choose the type of apomixis: obligate or facultative, gametophytic or sporophytic. Discuss advantages and disadvantages of your proposed method.
Kinetics: One-Compartment First-Order Absorption
1. In vivo testing provides valuable insight into a drug’s kinetics. Assessing drug kinetics following multiple routes of administration provides greater insight than a single route of administration alone. The following data was collected in 250-g rats following bolus IV, oral (PO), and intraperitoneal (ip) administration.
Using this data and set of graphs, determine:(calculate for each variable)
(a) k, C0, V, and AUC* for the bolus iv data
(b) k, ka, B1, and AUC* for the po data
c) k, ka, B1, and AUC* for the ip data
(d) relative bioavailability for po vs ip, Fpo/Fip
(e)absolute ip bioavailability, Fip
(f) absolute po bioavailability, Fpo
Chapter 6 Solutions
ND STONY BROOK UNIVERSITY LOOSELEAF GENETICS: FROM GENES TO GENOMES
Ch. 6 - Griffith, in his 1928 experiments, demonstrated...Ch. 6 - Griffith, in his 1928 experiments, demonstrated...Ch. 6 - During bacterial transformation, DNA that enters a...Ch. 6 - Nitrogen and carbon are more abundant in proteins...Ch. 6 - If 30 of the bases in human DNA are A, a what...Ch. 6 - Which of the following statements are true about...Ch. 6 - Imagine you have three test tubes containing...Ch. 6 - What information about the structure of DNA was...Ch. 6 - A portion of one DNA strand of the human gene...Ch. 6 - When a double-stranded DNA molecule is exposed to...
Ch. 6 - A particular virus with DNA as its genetic...Ch. 6 - The underlying structure of DNA is very simple,...Ch. 6 - Prob. 13PCh. 6 - Bacterial transformation and bacteriophage...Ch. 6 - The CAP protein is shown bound to DNA in Fig....Ch. 6 - In Meselson and Stahls density shift experiments...Ch. 6 - When Meselson and Stahl grew E. coli in 15N medium...Ch. 6 - If you expose human tissue culture cells for...Ch. 6 - Draw a replication bubble with both replication...Ch. 6 - a. Do any strands of nucleic acid exist in nature...Ch. 6 - As Fig. 6.21 shows, DNA polymerase cleaves the...Ch. 6 - The bases of one of the strands of DNA in a region...Ch. 6 - Replicating structures in DNA can be observed in...Ch. 6 - Indicate the role of each of the following in DNA...Ch. 6 - Draw a diagram of replication that is occurring at...Ch. 6 - Figure 6.18 depicts Watson and Cricks initial...Ch. 6 - Researchers have discovered that during...Ch. 6 - A DNA synthesizer is a machine that uses automated...Ch. 6 - Bacterial cells were coinfected with two types of...Ch. 6 - A yeast strain with a mutant spo11- allele has...Ch. 6 - Imagine that you have done a cross between two...Ch. 6 - The Neurospora octad shown came from a cross...Ch. 6 - From a cross between e f g and e f g strains of...Ch. 6 - In Step 6 of Fig. 6.27, the resolvase enzyme...Ch. 6 - Figure 6.31shows four potential outcomes of...Ch. 6 - Each of the substrates for site-specific...Ch. 6 - Prob. 37PCh. 6 - Suppose that you could inject a wild-type mouse...Ch. 6 - C31 is a type of bacteriophage that infects...Ch. 6 - Cre is a recombinase enzyme encoded by a gene in...Ch. 6 - Like Cre/loxP recombination, site-specific...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- 3. A promising new drug is being evaluated in human trials. Based on preliminary human tests, this drug is most effective when plasma levels exceed 30 mg/L. Measurements from preliminary tests indicate the following human pharmacokinetic parameter values: t1/2,elim = 4.6hr, t1/2,abs = 0.34hr, VD = 0.29 L/kg, Foral = 72%. Based on these parameters, estimate the following if a 49 kg woman were to receive a 1000mg oral dose of this drug: (a) Estimate the plasma concentration of the drug at 1hr, 6 hr, and 20hr after taking the drug ( Concentration estimate) (b) Estimate the time for maximum plasma concentration (tmax). (c) Estimate the maximum plasma concentration (Cmax). (d) Estimate the time at which the plasma level first rises above 30 mg/L. (Note this is a trial and error problem where you must guess a time, plug it into the concentration equation, and determine if it is close to 30 mg/L. Hint: based on part (a) it should be apparent that the answer is less than 1hr.) (e)…arrow_forwardList substitutions in your diet you could make to improve it based on what you know now about a balanced diet. For instance, if you like to drink soda, you might substitute skim milk or water for some of the soft drinks you consumed. List the item you wish to replace with the new item and what you hope to accomplish with that substitution. Be sure to choose foods you know that you'd enjoy and you consider more "healthful." If you feel your diet is already balanced, describe how you accomplish your balanced intake and when you began eating this way.arrow_forwardWhich single food item contained you ate for the 3 days with the most sodium?arrow_forward
- Select a diet and choose one site that provides credible information. Explain why the source itself and/or the information on the site is credible. This should be a report. This site should be different from U.S News and World Report. For full credit, you must include the following information and elaborate in detail: The diet name The main components of the diet The credible website name and link What makes the credible website credible?arrow_forwardSelect a diet and give a summary of the main components. Do a web search of the diet and choose one link that provides misinformation. Explain why the site itself and/or the information on the site is not credible. This should be a report. This site should be different from U.S News and World Report. For full credit, you must include the following information and elaborate in detail: The diet name The main components of the diet The misinformation website and link What misinformation is being provided in the other website and how did you determine it was not credible?arrow_forward1. In vivo testing provides valuable insight into a drug’s kinetics. Assessing drug kinetics following multiple different routes of administration provides greater insight than just a single route of administration alone. The following data was collected in 250 g rats following bolus iv, oral (po), and intraperitoneal (ip) administration.Using this data and set of graphs, determine: (a) k, C0, V, and AUC* for the bolus iv data (b) k, ka, B1, and AUC* for the po data (c) k, ka, B1, and AUC* for the ip data (d) relative bioavailability for po vs ip, Fpo/Fip (e) absolute po bioavailability, (f)Fpo absolute ip bioavailability, Fip MAKE SURE ANSWERS HAVE UNITS if appropriate. SHOW ALL WORK, including equation used, variables used and each step to your solution.arrow_forward
- 2. Drug quantification from plasma is commonly performed by using techniques such as HPLC or LC/MS. However, these methods do have limitations, and investigators may choose to use a radiolabeled analog of a drug instead. Radioligands are molecules that contain radioactive isotopes, commonly 3H or 14C. This technique allows investigators to quantify drug concentration from radiation measurements. The following measurements were made in 250 g rats following oral administration of 18.2 µCi of a 14C-labeled drug of interest: Time (min) Plasma Radiation Levels (µCi/L) 0 0.0 2 9.7 4 19.2 7 25.3 9 37.8 12 39.6 14 45.8 17 48.8 20 52.0 25 56.4 30 59.2 35 60.1 40 61.1 45 62.1 50 62.8 60 63.1 70 62.1 80 60.1 90 57.3 100 55.5 110 53.7 120 52.2 150 48.0 180 45.0 240 39.0 Note that a µCi is a measure of the amount of radioactivity and hence is a measure of the amount of drug present. Given that the oral bioavailability of this drug is known to be essentially 100%, estimate the following from this…arrow_forwardThe current nutrition labelling regulation in Hong Kong requires food manufacturer to list E+7 information on the package of pre-packaged food products. Do you think that more nutrients, such as calcium and cholesterol, shall be included?arrow_forwardView History Bookmarks Window Help Quarter cements ents ons (17) YouTube Which amino acids would you expect to find marked on the alpha helix? canvas.ucsc.edu ucsc Complaint and Grievance Process - Academic Personnel pach orations | | | | | | | | | | | | | | | | 000000 000000000 | | | | | | | | | | | | | | | | | | | | | | 00000000 scope vious De 48 12.415 KATPM FEB 3 F1 F2 80 F3 a F4 F5 2 # 3 $ 85 % tv N A の Mon Feb 3 10:24 PM Lipid bilayer Submit Assignment Next > ZOOM < Å DII 8 བ བ F6 16 F7 F8 F9 F10 34 F11 F12 & * ( 6 7 8 9 0 + 11 WERTY U { 0 } P deletearrow_forward
- Different species or organisms research for ecologyarrow_forwardWhat is the result of the following gram stain: positive ○ capsulated ○ acid-fast ○ negativearrow_forwardWhat type of stain is the image below: capsule stain endospore stain gram stain negative stain ASM MicrobeLibrary.org Keplingerarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage LearningHuman Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage LearningBiology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage LearningConcepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax CollegeHuman Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning
![Text book image](https://www.bartleby.com/isbn_cover_images/9781305389892/9781305389892_smallCoverImage.gif)
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
![Text book image](https://www.bartleby.com/isbn_cover_images/9781305251052/9781305251052_smallCoverImage.gif)
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
![Text book image](https://www.bartleby.com/isbn_cover_images/9781305117396/9781305117396_smallCoverImage.gif)
Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
![Text book image](https://www.bartleby.com/isbn_cover_images/9781337392938/9781337392938_smallCoverImage.gif)
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
![Text book image](https://www.bartleby.com/isbn_cover_images/9781938168116/9781938168116_smallCoverImage.gif)
Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College
![Text book image](https://www.bartleby.com/isbn_cover_images/9781305112100/9781305112100_smallCoverImage.gif)
Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning
Molecular Techniques: Basic Concepts; Author: Dr. A's Clinical Lab Videos;https://www.youtube.com/watch?v=7HFHZy8h6z0;License: Standard Youtube License