BIOLOGY
12th Edition
ISBN: 9781260169614
Author: Raven
Publisher: RENT MCG
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 53, Problem 7U
Summary Introduction
Introduction:
Optimal foraging theory is a model that helps to determine the animal behavior while searching for food. Food provides energy to the animal, but foraging or searching and capturing of food needs both energy and time. Optimal foraging theory suggests that natural selection favors those animals whose foraging behavior is such energetically efficient that their increased energy reserves result in increased reproductive success.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanks
Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?
What is amplification bias?
Chapter 53 Solutions
BIOLOGY
Ch. 53.1 - Prob. 1LOCh. 53.1 - Prob. 2LOCh. 53.1 - Prob. 3LOCh. 53.2 - Prob. 1LOCh. 53.2 - Prob. 2LOCh. 53.3 - Prob. 1LOCh. 53.3 - Prob. 2LOCh. 53.3 - Prob. 3LOCh. 53.4 - Prob. 1LOCh. 53.4 - Prob. 2LO
Ch. 53.4 - Prob. 3LOCh. 53.5 - Prob. 1LOCh. 53.5 - Prob. 2LOCh. 53.5 - Prob. 3LOCh. 53.6 - Prob. 1LOCh. 53.7 - Define migration.Ch. 53.7 - Prob. 2LOCh. 53.7 - Prob. 3LOCh. 53.8 - Prob. 1LOCh. 53.8 - Prob. 2LOCh. 53.8 - Prob. 3LOCh. 53.9 - Prob. 1LOCh. 53.9 - Prob. 2LOCh. 53.10 - Prob. 1LOCh. 53.10 - Prob. 2LOCh. 53.11 - Prob. 1LOCh. 53.11 - Prob. 2LOCh. 53.11 - Prob. 3LOCh. 53.12 - Prob. 1LOCh. 53.12 - Prob. 2LOCh. 53.12 - Prob. 3LOCh. 53.13 - Prob. 1LOCh. 53.13 - Prob. 2LOCh. 53.13 - Prob. 3LOCh. 53 - Prob. 1DACh. 53 - Prob. 2DACh. 53 - Prob. 3DACh. 53 - Prob. 4DACh. 53 - Prob. 5DACh. 53 - Prob. 1IQCh. 53 - Prob. 2IQCh. 53 - Prob. 3IQCh. 53 - What factors might be responsible for the slight...Ch. 53 - Prob. 1UCh. 53 - Prob. 2UCh. 53 - The study of song development in sparrows showed...Ch. 53 - Prob. 4UCh. 53 - Prob. 5UCh. 53 - Prob. 6UCh. 53 - Prob. 7UCh. 53 - Prob. 8UCh. 53 - In the haplodiploidy system of sex determination,...Ch. 53 - Prob. 10UCh. 53 - Prob. 11UCh. 53 - Prob. 1ACh. 53 - Refer to figure 54.25. Six pairs of birds were...Ch. 53 - Prob. 3ACh. 53 - Prob. 1SCh. 53 - Behavioral genetics has made great advances from...Ch. 53 - If a female bird chooses to live in the territory...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
- Biology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forwardBiology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage LearningBiology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage LearningHuman Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning

Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning

Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning

Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning
