
EBK BIOLOGY
11th Edition
ISBN: 8220106820636
Author: Martin
Publisher: CENGAGE L
expand_more
expand_more
format_list_bulleted
Question
Chapter 51, Problem 6TYU
Summary Introduction
Introduction: Deuterostomes are different from protostomes in the way that the first opening during development is for the development into the anus. A pore in the gastrula, which is formed first during the development of an organism, is called the blastopore. It is formed so that the embryo is able to interact and exchange materials with its surroundings.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Biology
How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?
Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?
The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?
Chapter 51 Solutions
EBK BIOLOGY
Ch. 51.1 - Prob. 1LOCh. 51.1 - Prob. 2LOCh. 51.1 - Prob. 1CCh. 51.1 - Prob. 2CCh. 51.2 - Prob. 3LOCh. 51.2 - Prob. 4LOCh. 51.2 - How do the mechanisms of fertilization ensure...Ch. 51.2 - Prob. 2CCh. 51.3 - Prob. 5LOCh. 51.3 - Contrast early development, including cleavage, in...
Ch. 51.3 - Prob. 1CCh. 51.3 - Prob. 2CCh. 51.3 - How do the amount and distribution of cytoplasm in...Ch. 51.4 - Identify the significance of gastrulation in the...Ch. 51.4 - Prob. 1CCh. 51.4 - How do the amount and distribution of yolk...Ch. 51.5 - Prob. 8LOCh. 51.5 - Prob. 9LOCh. 51.5 - Prob. 1CCh. 51.5 - Prob. 2CCh. 51.5 - Prob. 3CCh. 51.6 - Give the origins and functions of the chorion,...Ch. 51.6 - What are the roles of the chorion and amnion in...Ch. 51.6 - What are the functions of the allantois and yolk...Ch. 51.7 - Prob. 11LOCh. 51.7 - Prob. 12LOCh. 51.7 - Prob. 1CCh. 51.7 - How does the placenta form, and what is its...Ch. 51.7 - During which trimester does the cerebrum develop...Ch. 51.7 - Prob. 4CCh. 51 - The mechanism that leads directly to morphogenesis...Ch. 51 - Prob. 2TYUCh. 51 - Prob. 3TYUCh. 51 - Prob. 4TYUCh. 51 - Meroblastic cleavage is typical of embryos formed...Ch. 51 - Prob. 6TYUCh. 51 - Which of the following are mismatched? (a)...Ch. 51 - Prob. 8TYUCh. 51 - An unidentified substance (or substances) released...Ch. 51 - Which of the following consists of both fetal and...Ch. 51 - Prob. 11TYUCh. 51 - Prob. 12TYUCh. 51 - Prob. 13TYUCh. 51 - Prob. 14TYUCh. 51 - Prob. 15TYUCh. 51 - Prob. 16TYUCh. 51 - Prob. 17TYU
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
- Biology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forwardBiology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forward
- Biology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forwardDevelopmental Biology What is the definition of 1 M? (in the context of stock and dilutions)arrow_forward
- Biology You’ve received primer DNA in a tube from theprimer company. The tube has 20 nmole of primerDNA. In order to make 200 pmole/L of primer DNAstock solution, how much of sterile distilled watershould you add to the DNA tube? The volume ofprimer DNA is negligible.arrow_forwardBiology How would you make 1 L of 0.5X TBE buffer using5X TBE buffer solution and distilled water?arrow_forwardUnit Conversions: If the field of view at 10x is 3.1x106 µm2, what would it be in mm2. Report your answer with 2 significant digits. 1 mm = 1000 µm. Include units in your answer.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage LearningHuman Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage LearningBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
- Biology: The Unity and Diversity of Life (MindTap...BiologyISBN:9781305073951Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa StarrPublisher:Cengage LearningBiology: The Unity and Diversity of Life (MindTap...BiologyISBN:9781337408332Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa StarrPublisher:Cengage Learning

Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning

Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning

Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax


Biology: The Unity and Diversity of Life (MindTap...
Biology
ISBN:9781305073951
Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr
Publisher:Cengage Learning

Biology: The Unity and Diversity of Life (MindTap...
Biology
ISBN:9781337408332
Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Embryology | Fertilization, Cleavage, Blastulation; Author: Ninja Nerd;https://www.youtube.com/watch?v=8-KF0rnhKTU;License: Standard YouTube License, CC-BY