Campbell Biology
12th Edition
ISBN: 9780135188743
Author: Urry
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 5, Problem 7TYU
Which of the following pairs of base sequences could form a short stretch of a normal double helix of DNA?
(A) 5′-AGCT-3′ with 5′-TCGA-3′
(B) 5′-GCGC-3′ with 5′-TATA-3′
(C) 5′-ATGC-3′ with 5′-GCAT-3′
(D) All of these pairs are correct.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
A solution contains DNA polymerase and the Mg ²+ salts of dATP, dGTP, dCTP, and TTP. The following DNA molecules are added to aliquots of this solution. Which of them would lead to DNA synthesis? (a) A single-stranded closed circle containing 1000 nucleotide units. (b) A double-stranded closed circle containing 1000 nucleotide pairs. (c) A single-stranded closed circle of 1000 nucleotides base-paired to a linear strand of 500 nucleotides with a free 3' -OH terminus. (d) A double-stranded linear molecule of 1000 nucleotide pairs with a free 3’-OH group at each end.
Which of the following DNAs is most likely to contain the recognition sequence for a homodimeric DNA binding protein? (Note that only one strand of the DNA is shown - you will find it helpful to write down the sequence and the sequence of the opposite strand to answer this question.)
a) 5’- G A G C G A T C G C T C - 3’
b) 5’- G A G C G A G A G C G A - 3’
c) 5’- G A G C G A A G C G A G - 3’
Write the sequence of the complementary DNA strand that pairs with each of the following DNA base sequences:(a) TTAGCC(b) AGACAT
Chapter 5 Solutions
Campbell Biology
Ch. 5.1 - What are the four main classes of large biological...Ch. 5.1 - How many molecules of water are needed to...Ch. 5.1 - WHAT IF? If you eat a piece of fish, what...Ch. 5.2 - Write the formula for a monosaccharide that has...Ch. 5.2 - Prob. 2CCCh. 5.2 - WHAT IF? After a cow is given antibiotics to...Ch. 5.3 - Compare the structure of a fat (triglyceride) with...Ch. 5.3 - Why are human sex hormones considered lipids?Ch. 5.3 - Prob. 3CCCh. 5.4 - What parts of a polypeptide participate in the...
Ch. 5.4 - Prob. 2CCCh. 5.4 - Prob. 3CCCh. 5.4 - WHAT IF? Where would you expect a polypeptide...Ch. 5.5 - Prob. 1CCCh. 5.5 - Prob. 2CCCh. 5.6 - How would sequencing the entire genome of an...Ch. 5.6 - Given the function of DNA, why would you expect...Ch. 5 - What is the fundamental basis for the differences...Ch. 5 - Compare the composition, structure, and function...Ch. 5 - Why are lipids not considered to be polymers or...Ch. 5 - Explain the basis for the great diversity of...Ch. 5 - What role does complementary base pairing play in...Ch. 5 - Prob. 5.6CRCh. 5 - Which of the following categories includes all...Ch. 5 - The enzyme amylase can break glycosidic linkages...Ch. 5 - Prob. 3TYUCh. 5 - The structural level of a protein least affected...Ch. 5 - Enzymes that break down DNA catalyze the...Ch. 5 - The molecular formula for glucose is C6H12O6. What...Ch. 5 - Which of the following pairs of base sequences...Ch. 5 - Construct a table that organizes the following...Ch. 5 - Prob. 9TYUCh. 5 - EVOLUTION CONNECTION Comparisons of amino acid...Ch. 5 - SCIENTIFIC INQUIRY Suppose you are a research...Ch. 5 - WRITE ABOUT A THEME: ORGANIZATION Proteins, which...Ch. 5 - SYNTHESIZE YOUR KNOWLEDGE Given that the function...
Additional Science Textbook Solutions
Find more solutions based on key concepts
Q1. What is the empirical formula of a compound with the molecular formula
Chemistry: A Molecular Approach (4th Edition)
Single penny tossed 20 times and counting heads and tails: Probability (prediction): _______/20 heads ________/...
Laboratory Manual For Human Anatomy & Physiology
How does the removal of hydrogen atoms from nutrient molecules result in a loss of energy from the nutrient mol...
SEELEY'S ANATOMY+PHYSIOLOGY
Describe the role and impact of microbes on the earth.
Microbiology Fundamentals: A Clinical Approach
On what molecule does the anticodon appear? Explain the role of this molecule in protein synthesis.
Human Physiology: An Integrated Approach (8th Edition)
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Give the sequence of unpaired bases that would be sticky with the following sequences:(a) GGTAC (b) ACCCA (c) GTGTCarrow_forwardWrite the sequence of the complementary DNA strand thatpairs with each of the following DNA base sequences:(a) GGTTAC(b) CCCGAAarrow_forwardA DNA sequence can be represented as a string of the letters ACTG (short for adenine, cytosine, guanine, and thymine). (a) How many DNA sequences are exactly 24 letters long? (b) Given a DNA sequence of length 24, how many single letter mutations are possible? (c) Given a DNA sequence of length 24, how many double letter mutations are possible?arrow_forward
- Are the following base sequences “sticky” (complementary) or not? All sequences are written 5′ to 3′. (a) A-C-G-G-A and T-G-C-C-T (b) G-T-G-A-C and C-A-T-G-G(c) G-T-A-T-A and A-C-G-C-Garrow_forwardThe base composition of one of the DNA chains of a DNA double helix contains 18 mol-%A, 35 mol-%T, 26 mol-%C, and 21 mol-%G (a) What is the base composition of the complementary DNA chain? (b) Is the total amount of purine bases equal to the total amount of pyrimidine bases for the DNA double helix?arrow_forwardThe base analog 5-bromouracil (5BU), which sterically resembles thymine, more readily undergoes tautomerization from its keto form to its enol form than does thymine. 5BU can be incorporated into newly synthesized DNA when it pairs with adenine on the template strand. However, the enol form of 5BU pairs with guanine rather than adenine. (a) Draw the 5BU · G base pair. (b) What type of mutation results?arrow_forward
- Consider the following segment of DNA, which is part ofa much longer molecule constituting a chromosome:5′.…ATTCGTACGATCGACTGACTGACAGTC….3′3′.…TAAGCATGCTAGCTGACTGACTGTCAG….5′If the DNA polymerase starts replicating this segmentfrom the right,a. which will be the template for the leading strand?b. Draw the molecule when the DNA polymerase ishalfway along this segment.c. Draw the two complete daughter molecules.d. Is your diagram in part b compatible with bidirectional replication from a single origin, the usual modeof replication?arrow_forwardHow many possible nucleotide sequences are there for a stretch of DNA that is N nucleotides long, if it is (a) single- stranded or (b) double-stranded?arrow_forwardb) For a DNA strand with the given genetic code of bases , undergoing transcription, what will be the complimentary RNA strand? Provide the direction as well as 5" and 3" indicators for the new genetic genome. 5" G-A-A-C-T-G-G-A^T-T-C-T-A-C-C3'.arrow_forward
- What is the nucleotide sequence of the DNA strand that is complementary to 5'-GGCGCAACTGTCACAA-3'?arrow_forwardThe restriction endonuclease NciI recognizes and cuts the five-base-pair sequence 5’- CC(G/C)GG-3’ [where (G/C) means either G or C will work at that position]. (1) How often, on average, would this sequence occur in random DNA? Assume the DNA contains 25% each of A, G, T & C. (2) After digestion, Nci1 leaves a one-base 5’ overhang. Write/draw the cut site/digested products.arrow_forwardA closed circular duplex DNA has a 100-bp segment of alternating C and G residues. On transfer to a high salt solution, the segment undergoes a transition from the B conformation to the Z conformation. What is the change in its linking number, writhing number, and twist?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
DNA vs RNA (Updated); Author: Amoeba Sisters;https://www.youtube.com/watch?v=JQByjprj_mA;License: Standard youtube license