If a splinter penetrates the skin of the palm of the hand to the second epidermal layer from the surface, the last layer damaged is the
a. stratum granulosum. d. stratum
b. stratum basale. e. stratum spinosum.
c. stratum corneum.

Introduction:
The skin is comprised of 2 major tissue layers, the epidermis and the dermis. The epidermis is the superficial skin layer, comprising stratified epithelial squamous tissue. The multiple cell layers of the epidermis protects against the potential damage from abrasion on the skin's surface.
Answer to Problem 1RAC
The correct answer is option (d) stratum lucidum.
Explanation of Solution
Explanation/justification for the correct answer:
Option (d) stratum lucidum. The stratum lucidum in the epidermis is a thin, transparent layer of dead skin cells named for its translucent appearance under a microscope. It is easily noticeable by light microscopy only in regions of thick skin found on the hands ' palms and feet's soles. So, the correct answer is option (d).
Explanation for incorrect answer:
Option (a) stratum granulosum. A thin layer of cells in the epidermis is the stratum granulosum (or granular layer). Keratinocytes that migrate from the underlying stratum spinosum are known in this layer as granular cells. So, this is an incorrect option.
Option (b) stratum basale. The stratum basale is the deepest layer of the five layers of the epidermis, which cover the outside of the skin in mammals and is sometimes called as the stratum germinativum. So, this is an incorrect option.
Option (c) stratum corneum. Stratum corneum is the peripheral layer of the skin, comprising of keratinized cells. The stratum corneum, or the skin boundary, goes about as our first line of resistance against the outer condition. It is a compact layer of cells and lipids that has two basic capacities: it shields our bodies from microorganisms, UV harm and other assaults; and avoids natural moisture from escaping, to keep skin hydrated. So, this is an incorrect option.
Option (e) stratum spinosum. Stratum spinosum is a superficial stratum basale which consists of 8 to10 layers of multi-sided cells. As the cells in this stratum are pushed to the ground, they flattened; desmosomes break apart and fresh desmosomes form. So this is an incorrect option.
If a splinter penetrates the skin of the palm of the hand to the second epidermal layer from the surface, the last layer damaged is the stratum lucidum. Hence, the correct answer is option (d) small intestine.
Want to see more full solutions like this?
Chapter 5 Solutions
Seeley's Anatomy & Physiology
- series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forward
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
- Anatomy & PhysiologyBiologyISBN:9781938168130Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark WomblePublisher:OpenStax College
- Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning


