Seeley's Anatomy & Physiology
11th Edition
ISBN: 9781259254963
Author: Jennifer Regan (author), Andrew Russo (author), Rod Seeley (author) Cinnamon Vanputte (author)
Publisher: McGraw Hill Higher Education
expand_more
expand_more
format_list_bulleted
Question
Chapter 5.5, Problem 28AYP
Summary Introduction
To write:
The name of the locations where cholecalciferol is produced and then modified into vitamin D and its function.
Introduction:
The diet must be supplemented with vitamin D in fortified milk or vitamin pills. Egg yolks and dairy products are the natural sources of vitamin D. The synthesis of vitamin D starts in skin when it exposed to ultraviolet light. If enough ultraviolet light is available, people can generate all the vitamin D they need through this process.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Biology
You’re going to analyze 5 ul of your PCR product(out of 50 ul) on the gel. How much of 6X DNAloading buffer (dye) are you going to mix with yourPCR product to make final 1X concentration ofloading buffer in the PCR product-loading buffermixture?
Write the assignment on the title "GYMNOSPERMS" focus on the explanation of its important families, characters and reproduction.
Awnser these
Discussion Questions
Answer these discussion questions and submit them as part of your lab report.
Part A: The Effect of Temperature on Enzyme Activity
Graph the volume of oxygen produced against the temperature of the solution.
How is the oxygen production in 30 seconds related to the rate of the reaction?
At what temperature is the rate of reaction the highest? Lowest? Explain.
Why might the enzyme activity decrease at very high temperatures?
Why might a high fever be dangerous to humans?
What is the optimal temperature for enzymes in the human body?
Part B: The Effect of pH on Enzyme Activity
Graph the volume of oxygen produced against the pH of the solution.
At what pH is the rate of reaction the highest? Lowest? Explain.
Why does changing the pH affect the enzyme activity?
Research the enzyme catalase. What is its function in the human body?
What is the optimal pH for the following enzymes found in the human body? Explain. (catalase, lipase (in your stomach),…
Chapter 5 Solutions
Seeley's Anatomy & Physiology
Ch. 5.1 - Provide on example for each function of the...Ch. 5.2 - From deepest to most superficial, name and...Ch. 5.2 - Prob. 3AYPCh. 5.2 - Prob. 4AYPCh. 5.2 - Prob. 5AYPCh. 5.2 - How do gentic factors, exposure to sunlight, and...Ch. 5.2 - How do carotene, blood flow, oxygen content, and...Ch. 5.2 - Prob. 8AYPCh. 5.2 - Prob. 9AYPCh. 5.2 - What are cleavage lines, and how are they related...
Ch. 5.3 - Name the types of tissue forming the subcutaneous...Ch. 5.3 - Prob. 12AYPCh. 5.3 - Prob. 13AYPCh. 5.4 - When and where are Ianugo, vellus, and found in...Ch. 5.4 - Prob. 15AYPCh. 5.4 - Prob. 16AYPCh. 5.4 - Describe the ports of a hair follicle. How the...Ch. 5.4 - Prob. 18AYPCh. 5.4 - Prob. 19AYPCh. 5.4 - Prob. 20AYPCh. 5.4 - Prob. 21AYPCh. 5.4 - Which glands of the skin are responsible for...Ch. 5.4 - Name the ports of a nail. Which Port produces most...Ch. 5.4 - Prob. 24AYPCh. 5.5 - In what ways does the skin provide protection?Ch. 5.5 - Prob. 26AYPCh. 5.5 - Prob. 27AYPCh. 5.5 - Prob. 28AYPCh. 5.5 - Prob. 29AYPCh. 5.6 - Prob. 30AYPCh. 5.7 - Compared with young skin, why is aged skin more...Ch. 5.7 - Prob. 32AYPCh. 5.7 - Prob. 33AYPCh. 5.7 - Prob. 34AYPCh. 5 - If a splinter penetrates the skin of the palm of...Ch. 5 - Prob. 2RACCh. 5 - Prob. 3RACCh. 5 - Prob. 4RACCh. 5 - Prob. 5RACCh. 5 - Prob. 6RACCh. 5 - Prob. 7RACCh. 5 - Prob. 8RACCh. 5 - Prob. 9RACCh. 5 - Prob. 10RACCh. 5 - Prob. 11RACCh. 5 - Prob. 12RACCh. 5 - Prob. 13RACCh. 5 - Prob. 14RACCh. 5 - Prob. 15RACCh. 5 - Smooth muscles that are attached to hair follicles...Ch. 5 - Prob. 17RACCh. 5 - For questions 17-19, match the type of gland with...Ch. 5 - Prob. 19RACCh. 5 - Prob. 20RACCh. 5 - Prob. 21RACCh. 5 - Prob. 22RACCh. 5 - Which of these processes increase (s) heat loss...Ch. 5 - Prob. 24RACCh. 5 - The skin of infants is more easily penetrated and...Ch. 5 - Melanocytes are found primarily in the stratum...Ch. 5 - The rare of water loss from the skin of a hand was...Ch. 5 - It has been several weeks since George has...Ch. 5 - Prob. 5CTCh. 5 - Why are your eyelshes not a foot long? Your...Ch. 5 - Pulling on hair can be quite painful, hyet cutting...Ch. 5 - A patient has an ingrown toenail, in which the...Ch. 5 - Defend or refute the following statement:...Ch. 5 - Harry, age 55, went to a health fair and had a PSA...
Knowledge Booster
Similar questions
- Anwser these Discussion Questions: Part One Why were the plants kept in the dark prior to the experiment? Why is this important? Why is it important to boil the leaf? Explain why it was necessary to use boiling alcohol? What is the purpose of the iodine? Part Two What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out? What conclusions can you draw from this part of the lab? Part Three 7. In this experiment what was the purpose of adding the soda lime? 8. Why was a sealed bag placed around each plant? 9. What happened in the control plants? 10. What was the result on photosynthesis? Part Four 11. Why was a variegated leaf used in this experiment? !2. What conclusions can you draw about starch production in a variegated leaf?arrow_forwardHow did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forward
- What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forward
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Essentials of Pharmacology for Health ProfessionsNursingISBN:9781305441620Author:WOODROWPublisher:CengageHuman Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage LearningHealth Safety And Nutrition F/Young ChildHealth & NutritionISBN:9781305144767Author:MAROTZPublisher:Cengage
Essentials of Pharmacology for Health Professions
Nursing
ISBN:9781305441620
Author:WOODROW
Publisher:Cengage

Human Physiology: From Cells to Systems (MindTap ...
Biology
ISBN:9781285866932
Author:Lauralee Sherwood
Publisher:Cengage Learning
Health Safety And Nutrition F/Young Child
Health & Nutrition
ISBN:9781305144767
Author:MAROTZ
Publisher:Cengage