BIOLOGY
12th Edition
ISBN: 9781260169614
Author: Raven
Publisher: RENT MCG
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 49.1, Problem 2LO
Summary Introduction
To classify: Organisms depending on their osmotic regulation.
Introduction: Osmosis refers to the process of diffusion of water molecules across a semipermeable membrane. This movement of water molecules typically occurs to a less dilute solute from a more dilute solute. The osmotic pressure denotes the measure of the solution’s tendency to gain water molecules through osmosis. A solution’s tonicity indicates the measure of its ability to alter the cell’s volume through osmosis. An animal cell takes in water in a hypotonic solution, excretes water in a hypertonic solution, and no net exchange of water is observed when placed in an isotonic solution.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Anwser these
Discussion Questions:
Part One
Why were the plants kept in the dark prior to the experiment? Why is this important?
Why is it important to boil the leaf?
Explain why it was necessary to use boiling alcohol?
What is the purpose of the iodine?
Part Two
What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out?
What conclusions can you draw from this part of the lab?
Part Three
7. In this experiment what was the purpose of adding the soda lime?
8. Why was a sealed bag placed around each plant?
9. What happened in the control plants?
10. What was the result on photosynthesis?
Part Four
11. Why was a variegated leaf used in this experiment?
!2. What conclusions can you draw about starch production in a variegated leaf?
How did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?
series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups?
Loci
a and b
Percent Recombination
50
a and c
14
a and d
10
a and e
50
a and f
50
b and c
50
b and d
50
b and e
35
b and f
20
c and d
5
c and e
50
c and f
50
d and e
50
d and f
50
18
e and f
Selected Answer:
n6
Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances.
Z
e.g. Linkage group 1=P____5 mu__Q____12 mu
R
38 mu
5 Linkage group 2-X_____3 mu__Y_4 mu
sanight
Chapter 49 Solutions
BIOLOGY
Ch. 49.1 - Prob. 1LOCh. 49.1 - Prob. 2LOCh. 49.2 - Identify the relative toxicity and solubility of...Ch. 49.3 - Prob. 1LOCh. 49.3 - Define reabsorption and secretion.Ch. 49.4 - Prob. 1LOCh. 49.4 - Explain the role of the loop of Henle in the...Ch. 49.5 - Prob. 1LOCh. 49.5 - Prob. 2LOCh. 49.5 - Prob. 3LO
Ch. 49.6 - Prob. 1LOCh. 49.6 - Prob. 2LOCh. 49 - Prob. 1DACh. 49 - Which of the following is NOT an ion...Ch. 49 - Prob. 2UCh. 49 - A sharks blood is isotonic to the surrounding...Ch. 49 - An important function of the excretory system is...Ch. 49 - Which of the following is a function of the...Ch. 49 - Humans excrete their excess nitrogenous wastes as...Ch. 49 - An osmoregulator would maintain its internal...Ch. 49 - Prob. 1ACh. 49 - A viral infection that specifically interferes...Ch. 49 - Diuretics are drugs that can be used to treat high...Ch. 49 - Caffeine inhibits the secretion of ADH. Prior to...Ch. 49 - You and your study partner want to draw the...Ch. 49 - You are studying renal function in different...Ch. 49 - Prob. 1SCh. 49 - Johns doctor is concerned that Johns kidneys may...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forward
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
- Biology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage LearningHuman Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage LearningHuman Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage Learning

Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning

Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning

Human Physiology: From Cells to Systems (MindTap ...
Biology
ISBN:9781285866932
Author:Lauralee Sherwood
Publisher:Cengage Learning

Microbial Nutrition and Growth; Author: Scientist Cindy;https://www.youtube.com/watch?v=rK3UkyWjkl8;License: Standard YouTube License, CC-BY