Whether the argument over the cats has as much right to be there as the birds are justified or not. Concept introduction: A biological community is an interacting group of various species that live in a common location. As per ecological point of view, community is an association of populations of various species occupying the particular geographical area.

Question

Want to see the full answer?

Answer 1

Question

Chapter 48, Problem 2CT

Summary Introduction

To explain: Whether the argument over the cats has as much right to be there as the birds are justified or not.

Concept introduction: A biological community is an interacting group of various species that live in a common location. As per ecological point of view, community is an association of populations of various species occupying the particular geographical area.

Summary Introduction

To explain: Why the arguments over the cats has as much right to be there as the birds are not justified.

Concept introduction: A biological community is an interacting group of various species that live in a common location. As per ecological point of view, community is an association of populations of various species occupying the particular geographical area.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Students have asked these similar questions

There are six species of animals in an area at the end of Thunder Bay. The area is wooded land covering rolling hills with two small rivers. Most of the area is surrounded by farm land where people have sheep and cows. There are three roads in the area, one of which leads to an expanding subdivision. a) Chose the species you believe to be most likely to become endangered and the species you believe to be least likely to become endangered. Compare and contrast these two species to explain your decision b) Which two species do you think would be most likely to exhibit a competitive relationship? c) Explain two density-dependent factors that may affect population P in this area d) Explain two density-independent factors that may affect population P in this area

Hunting is banned in all national parks but not outside of them. During bear hunting season, conservation officers conduct routine checks. One day, the OPP receive a report from campers that they heard shots fired inside Algonquin National Park. The OPP transmits this information to the Natural Resources office. Based on the campers' tip, check points are set up on the highway through Huntsville. All of the hunters that bring bears past the checkpoint have licenses, but in order to check out the camper's story several hairs are pulled from each carcass for DNA checks. The data below shows DNA containing two STR regions for the bear carcasses that were examined on the day after the campers' complaint, and two known reference samples of bear sub-populations around Huntsville, including inside the park. POSSIBLE POACHER'S DNA DATA Reference #1: Genotype Indigenous to Park TCAGGGACGACGACGACGACGACGACCCATTATCGGAGTTATTATTAGATCGATCCATTCGGATCGGATAT Reference #2: Genotype Indigenous to Park…

The International Union for the Conservation of Nature and Natural Resources (IUCN), has declared 418 animal species in the Philippines to threatened: meaning they are either vulnerable, endangered, or critically endangered. What small steps that you can do to save these animals?

Answer 2

Question

Chapter 48, Problem 2CT

Summary Introduction

To explain: Whether the argument over the cats has as much right to be there as the birds are justified or not.

Concept introduction: A biological community is an interacting group of various species that live in a common location. As per ecological point of view, community is an association of populations of various species occupying the particular geographical area.

Summary Introduction

To explain: Why the arguments over the cats has as much right to be there as the birds are not justified.

Concept introduction: A biological community is an interacting group of various species that live in a common location. As per ecological point of view, community is an association of populations of various species occupying the particular geographical area.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 3

Question

Chapter 48, Problem 2CT

Summary Introduction

To explain: Whether the argument over the cats has as much right to be there as the birds are justified or not.

Concept introduction: A biological community is an interacting group of various species that live in a common location. As per ecological point of view, community is an association of populations of various species occupying the particular geographical area.

Summary Introduction

To explain: Why the arguments over the cats has as much right to be there as the birds are not justified.

Concept introduction: A biological community is an interacting group of various species that live in a common location. As per ecological point of view, community is an association of populations of various species occupying the particular geographical area.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 4

Question

Chapter 48, Problem 2CT

Summary Introduction

To explain: Whether the argument over the cats has as much right to be there as the birds are justified or not.

Concept introduction: A biological community is an interacting group of various species that live in a common location. As per ecological point of view, community is an association of populations of various species occupying the particular geographical area.

Summary Introduction

To explain: Why the arguments over the cats has as much right to be there as the birds are not justified.

Concept introduction: A biological community is an interacting group of various species that live in a common location. As per ecological point of view, community is an association of populations of various species occupying the particular geographical area.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 5

Chapter 48, Problem 2CT

Summary Introduction

To explain: Whether the argument over the cats has as much right to be there as the birds are justified or not.

Concept introduction: A biological community is an interacting group of various species that live in a common location. As per ecological point of view, community is an association of populations of various species occupying the particular geographical area.

Summary Introduction

To explain: Why the arguments over the cats has as much right to be there as the birds are not justified.

Concept introduction: A biological community is an interacting group of various species that live in a common location. As per ecological point of view, community is an association of populations of various species occupying the particular geographical area.

Answer 6

Chapter 48, Problem 2CT

Summary Introduction

To explain: Whether the argument over the cats has as much right to be there as the birds are justified or not.

Concept introduction: A biological community is an interacting group of various species that live in a common location. As per ecological point of view, community is an association of populations of various species occupying the particular geographical area.

Answer 7

Chapter 48, Problem 2CT

Summary Introduction

To explain: Whether the argument over the cats has as much right to be there as the birds are justified or not.

Concept introduction: A biological community is an interacting group of various species that live in a common location. As per ecological point of view, community is an association of populations of various species occupying the particular geographical area.

Answer 8

Summary Introduction

To explain: Why the arguments over the cats has as much right to be there as the birds are not justified.

Concept introduction: A biological community is an interacting group of various species that live in a common location. As per ecological point of view, community is an association of populations of various species occupying the particular geographical area.

Answer 9

Summary Introduction

To explain: Why the arguments over the cats has as much right to be there as the birds are not justified.

Concept introduction: A biological community is an interacting group of various species that live in a common location. As per ecological point of view, community is an association of populations of various species occupying the particular geographical area.

Answer 10

Expert Solution & Answer

Answer 11

Expert Solution & Answer

Answer 12

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 13

Ch. 48 - Bioaccumlation in tuna Bluefin tuna are among the...Ch. 48 - Prob. 2DAA Ch. 48 - Prob. 3DAA Ch. 48 - Prob. 4DAA Ch. 48 - Prob. 1SQ Ch. 48 - Prob. 2SQ Ch. 48 - Prob. 3SQ Ch. 48 - Prob. 4SQ Ch. 48 - Prob. 5SQ Ch. 48 - With biological magnification, a ___ will have the...

Solution Summary: The author explains that a biological community is an association of populations of various species occupying the particular geographical area.

Concept explainers

Want to see the full answer?

Chapter 48 Solutions