Bundle: Biology: The Unity and Diversity of Life, 14th + LMS Integrated for MindTap Biology, 1 term (6 months) Printed Access Card
14th Edition
ISBN: 9781305774384
Author: Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr
Publisher: Cengage Learning
expand_more
expand_more
format_list_bulleted
Textbook Question
Chapter 47, Problem 3CT
The use of off-road recreational vehicles may double in the next 20 years. Enthusiasts would like increased access to government-owned deserts. Some argue that it’s the perfect place for off-roaders because “There’s nothing there.” Explain whether you agree, and why.
Expert Solution & Answer
Trending nowThis is a popular solution!
Students have asked these similar questions
Do you think oil drilling should be permitted in the Arctic National Wildlife Refuge? Describe it's pros and cons.
When a fossil fuel reserves decreases, the cost of fossil fuel energy will be more affordable for most people . Why is this an unlikely scenario?
Many argue that government freshwater subsidies promote the expansion of productive farmland, stimulate local economies, and help to keep food and electricity prices low. Do you think this is reason enough for governments to continue providing subsidies to farmers and cities? Why or why not? Incorporate what type of feedback would be needed to garner enough legislative support for your position.
Chapter 47 Solutions
Bundle: Biology: The Unity and Diversity of Life, 14th + LMS Integrated for MindTap Biology, 1 term (6 months) Printed Access Card
Ch. 47 - Prob. 1SQCh. 47 - Prob. 2SQCh. 47 - Warm air ______ and it holds _____ water than cold...Ch. 47 - A rain shadow is a reduction in rainfall ________....Ch. 47 - Prob. 1DAACh. 47 - Prob. 2DAACh. 47 - Prob. 3DAACh. 47 - Prob. 4DAACh. 47 - Prob. 5SQCh. 47 - Prob. 6SQ
Ch. 47 - Biome distribution depends on ______. a. climate...Ch. 47 - Prob. 8SQCh. 47 - Prob. 9SQCh. 47 - Prob. 10SQCh. 47 - Chemoautotrophic bacteria and archaea are the main...Ch. 47 - Prob. 12SQCh. 47 - Prob. 13SQCh. 47 - Unrelated species in geographically separated...Ch. 47 - Match the terms with the most suitable...Ch. 47 - London, England, is at the same latitude as...Ch. 47 - Increased industrialization in China has...Ch. 47 - The use of off-road recreational vehicles may...
Additional Science Textbook Solutions
Find more solutions based on key concepts
What is the difference between histology and radiography?
Human Anatomy (8th Edition)
Why are mutants used as test organisms in the Ames test?
Laboratory Experiments in Microbiology (11th Edition)
2. Why is it that the range of resting blood pressures of humans is best represented by a bell-shaped curve co...
Human Biology: Concepts and Current Issues
Problem Set
True or False? Indicate whether each of the following statements about membrane transport is true (...
Becker's World of the Cell (9th Edition)
Propose a model for the assembly of a flagellum in a typical Gram-positive cell envelope.
Prescott's Microbiology
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- We encounter so many risks in our daily lives ranging from just crossing the street to get to work or school, to our recreational favorites. How can we justify the resources being spent on environmental risks when those risks may be less than that encountered in a day surfing at the shore, skiing, bicycling or just driving to work?arrow_forwardLand Use in the United States Parks and preserves 13% Urban land 6% Cropland 20% Other 7% Forest land 28% Rangeland and pasture 26% What percentage of land is being used by humans to raise crops & graze livestock? What percentage of land is not available for growing food? Explain your answer.arrow_forwardWhat are some advantages of ecotourism for a state like Hawai‘i? What might be a potential disadvantage? Describe a source of ecotourism that exists—or could exist—in your own regionarrow_forward
- About O 16% O 20% O 36% O 26% O 46% of U.S. land is used as grassland, pasture and range.arrow_forwardWhich of the following resources is currently considered renewable but may become a nonrenewable resource as Earth's population expands? a water b timber c coal d windarrow_forwardCities can’t ever be sustainable because they have such high concentrations of people, automobiles, business enterprises, and industries. True Falsearrow_forward
- A group of researchers are assessing energy availability in a terrestrial ecosystem. The image shows the food web for this ecosystem. They set up three plots and assess the biomass of producers, primary consumers, and secondary consumers. Rabbits and grasshoppers feed on ground cover plants that grow on the forest floor. Plot 1 is composed of mature hardwood trees, and only 25% of the sunlight reaches the shrubs and grasses compared to plots 2 and 3, which have fewer trees and allow more sunlight to reach the forest floor. Based on the food web shown here, which of the following best describes how the reduction in sunlight to the forest floor would impact the number of primary consumers (squirrel, grasshopper, rabbit, and deer) in plot 1 compared to the other plots? A - Plot 1 will show an increase in deer only because they feed on trees. B - Plot 1 will show a decrease in squirrels and rabbits, while deer and grasshoppers will increase. C - Plot 1 will show a decrease in rabbits and…arrow_forwardInterpreting Data In a classic study, John Teal measured energy flow in a salt marsh ecosystem. The table below shows some of his results. Form of energy Kcal/m?/yr Efficiency of energy transfer (%) Sunlight 600,000 n/a Chemical energy in producers Chemical energy in primary consumers 6,585 81 Data from: J. M. Teal, Energy Flow in the Salt Marsh Ecosystem of Georgia. Ecology 43: 614-24 (1962). a. Calculate the efficiency of energy transfer by the producers. That is, what percentage of the energy in sunlight was converted into chemical energy and incorporated into plant biomass? b. Calculate the efficiency of energy transfer by the primary consumers. What percentage of the energy in plant biomass was incorporated into the bodies of the primary consumers? What became of the rest of the energy? c. How much energy is available for secondary consumers? Based on the efficiency of energy transfer by primary consumers, estimate how much energy will be available to tertiary consumers. d. Draw a…arrow_forwardIlog PasigLahin is one of the non-government organizations (NGO) concerned with environmental awareness and protection, particularly along the Pasig River. As a student, what can you do to support and protect bodies of water in the Philippines, like the Pasig River? What actions will you be able to take? to help mitigate the current climate change?arrow_forward
- Urban forests, green roofs, parks, and other green spaces can improve environmental conditions for city dwellers in a number of ways. (g) In addition to improving air quality and reducing energy usage in cities, increasing the amount of vegetation can decrease urban runoff. Describe one way increasing the amount of vegetation in cities can lead to decreased runoff. (h) Describe one cultural benefit that may result from increasing the amount of vegetation in cities.arrow_forwardThe Amazon rainforest continues to be cleared for agricultural land. For each square meter of this rainforest area that was cleared and replaced by farmland, by about how much was NPP reduced each year? Show how you got your answer.arrow_forwardHunting is banned in all national parks but not outside of them. During bear hunting season, conservation officers conduct routine checks. One day, the OPP receive a report from campers that they heard shots fired inside Algonquin National Park. The OPP transmits this information to the Natural Resources office. Based on the campers' tip, check points are set up on the highway through Huntsville. All of the hunters that bring bears past the checkpoint have licenses, but in order to check out the camper's story several hairs are pulled from each carcass for DNA checks. The data below shows DNA containing two STR regions for the bear carcasses that were examined on the day after the campers' complaint, and two known reference samples of bear sub-populations around Huntsville, including inside the park. POSSIBLE POACHER'S DNA DATA Reference #1: Genotype Indigenous to Park TCAGGGACGACGACGACGACGACGACCCATTATCGGAGTTATTATTAGATCGATCCATTCGGATCGGATAT Reference #2: Genotype Indigenous to Park…arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology: The Unity and Diversity of Life (MindTap...BiologyISBN:9781305073951Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa StarrPublisher:Cengage LearningHuman Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage LearningUnderstanding Health Insurance: A Guide to Billin...Health & NutritionISBN:9781337679480Author:GREENPublisher:Cengage
Biology: The Unity and Diversity of Life (MindTap...
Biology
ISBN:9781305073951
Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning
Understanding Health Insurance: A Guide to Billin...
Health & Nutrition
ISBN:9781337679480
Author:GREEN
Publisher:Cengage
Guidelines for Physical Activity; Author: Versus Arthritis;https://www.youtube.com/watch?v=Nt3Qh_oJ3YY;License: Standard Youtube License