
Concept explainers
To determine:
The reason that the mammalian and reptilian diversity are present so low on the islands.
Introduction:
Biodiversity is termed as the measurement of variation at the genetic, species, and ecosystem level. It is variability within living organisms from all sources. It increases the stability and resilience of the ecosystem.
Island biogeography determines many factors which are affecting the species of the communities that are isolated. The given theory of island biogeography shows the entire number of species which are can survive on an island. These numbers are the result of measuring extinction and immigration.

Explanation of Solution
Many factors can influence the biodiversity of an island. However, they may lead to reduce the diversity of an island. Human activities are the major key factors that can disrupt the biodiversity of an island. Human activities such as hunting play a role in animal extinction. For example: dodo is a bird that was a predominant species presenting on an island of Mauritius. Due to the human hunting and predators, the species got extinct.
Habitat destruction is a factor that can well define the low biodiversity of reptiles and mammals. Natural
Smaller animals get fed by predators on the island. Due to the imbalance between higher and smaller animals, biodiversity gets affected on the islands. Trophic cascades and global warming are also responsible for the low numbers of animals on the island. This affects the numbers of mammals and reptiles on the island.
All the factors given above can cause a low diversity of mammals and reptiles on the islands.
Want to see more full solutions like this?
Chapter 45 Solutions
Lab Manual for Biology
- series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forward
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education





