Concept explainers
Introduction:
The relationship among living organisms related to energy sources is organized into different trophic levels. Organisms that utilize the sunlight energy to produce their food are known as producers. Organisms that obtain their food from the primary producers are known as primary consumers. Further, organisms that depend on the primary consumers for their food requirements are known as secondary consumers. The detritivores or decomposers are organisms that obtain their food from the dead and decaying matter.

Answer to Problem 1TYU
Correct answer:
The zooplankton is incorrectly matched with its tropic level. As the zooplankton is a detritivore, it can be considered as a primary or a secondary consumer. Therefore, option (C) is correct.
Explanation of Solution
Reasons for the correct statement:
Zooplanktons are a group of organisms and are detritivore in nature. They feed on other organisms for the requirement of food. They mainly feed on bacterioplankton and phytoplankton. The primary producers are referred to as organisms, which prepare food on their own.
Option (C) is given as “zooplankton-primary producer”.
“The zooplankton is matched with primary producer”; hence, it the correct answer.
Hence, option (C) is correct.
Reasons for the incorrect statements:
Option (A) is given as “cyanobacterium—primary producer”.
The cyanobacterium is the aquatic bacterium that performs the process of photosynthesis to obtain its energy. The cyanobacterium is included in the category of the primary producer. Hence, it is the wrong answer.
Option (B) is given as “grasshopper—primary consumer”.
The grasshopper is an organism that feeds on plants. It is a primary consumer. Hence, it is the wrong answer.
Option (D) is given as “
The fungal species fall into the category of decomposers or detritivores. Hence, it is the wrong answer.
Hence, options (A), (B), and (D) are incorrect.
The zooplankton feeds on dead organic matter and small organisms, which perform photosynthesis, like phytoplankton. Hence, the zooplankton is a detritivore, primary, or a secondary consumer.
Want to see more full solutions like this?
Chapter 42 Solutions
Campbell Biology In Focus, Loose-leaf Edition (3rd Edition)
- series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forward
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
- Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax CollegeBiology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
- Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning



