Concept explainers
Introduction: The cells having a similar structure and function associate with each other to form a tissue. In a body, the tissues are classified on the basis of their different structures and functions. In the animal body, the major types of tissues are muscle, nervous, epithelial, and connective tissues.

Answer to Problem 1TY
Correct answer: Tissue that is specialized to conduct electrical signals from one structure in the body to another structure is nervous tissue. Hence, the correct answer is option c.
Explanation of Solution
Reason for correct answer:
Nervous tissues are made up of nerve cells which are known as neurons. These neurons are the cells specialized to receive information from one part of the body and send it to another part of the body. The activities of the cells are regulated by nervous tissues in the body.
Option c. is given as “nervous”.
Nervous tissues are responsible to transmit signals from one part to another part of the body. Hence, the correct answer is option c.
Reasons for incorrect answers:
Option a. is given as, “epithelial”.
Epithelial tissues are made up of densely packed cells which act as a sheath and cover the body and its organs. The function of epithelial tissues is to protect the body from external environmental damage and to release some organic molecules. Hence, option a. is incorrect.
Option b. is given as, “connective”.
The tissues which form a connection between the structures of the body are known as connective tissue. Blood is an example of connective tissue. Hence, option b. is incorrect.
Option d. is given as, “muscle”.
Muscle tissues are responsible for the contraction and relaxation of the muscles. These tissues play an important role in the movement of the animal’s body. Hence, option d. is incorrect.
Hence, the options a., b., and d. are incorrect.
Thus, electrical signals are conducted by the nervous tissues.
Want to see more full solutions like this?
Chapter 41 Solutions
BIOLOGY (LL)
- Anwser these Discussion Questions: Part One Why were the plants kept in the dark prior to the experiment? Why is this important? Why is it important to boil the leaf? Explain why it was necessary to use boiling alcohol? What is the purpose of the iodine? Part Two What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out? What conclusions can you draw from this part of the lab? Part Three 7. In this experiment what was the purpose of adding the soda lime? 8. Why was a sealed bag placed around each plant? 9. What happened in the control plants? 10. What was the result on photosynthesis? Part Four 11. Why was a variegated leaf used in this experiment? !2. What conclusions can you draw about starch production in a variegated leaf?arrow_forwardHow did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forward
- What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forward
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
- Human Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage LearningBiology: The Unity and Diversity of Life (MindTap...BiologyISBN:9781305073951Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa StarrPublisher:Cengage Learning



