
To determine:
The type of disease or symptoms occur after a ligating the pancreatic duct of dogs.
Introduction:
Pancreas is a gland found in the upper abdomen. Pancreas is consisting of both endocrine and exocrine tissues. It serves as digestive exocrine gland and hormone releasing endocrine gland.

Explanation of Solution
There are two types of glandular systems: The endocrine glands and exocrine glands. The glands of the endocrine system release their content directly into the blood circulation and regulate other organs of the body. They have no ducts. Thus, called as the ductless glands. The glands of exocrine system release their content into ducts that move the content to the target tissue. Their secretion is carried to the lumen of other organs or to the body’s surface.
Pancreas act as both exocrine and endocrine system. Pancreas secretes digestive juice through pancreatic duct, so it acts as exocrine gland. It also secretes the hormone like insulin and glucagon directly into the blood, so it acts as an endocrine gland. The ligation of pancreatic duct causes the degeneration of those cells that secrete digestive juice.
The ligation only damages the exocrine tissue, and leaves the endocrine organ intact. The symptoms that occur due to the ligation of the pancreatic duct are: gastritis, acidity and ulcers. Also, the animal is not being able to digest their food because of the degeneration of exocrine tissue (pancreatic duct) which secretes digestive juice.
The symptoms that occur after the ligation of pancreatic duct are: gastritis, acidity and ulcer.
Want to see more full solutions like this?
Chapter 40 Solutions
Lab Manual for Biology
- series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forward
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education





