Concept explainers
To explain: The ways by which interspecific interactions are classified and also elaborate with an example.
Introduction:- The term interspecific is derived from Latin word that means between species. Interspecific interaction occurs between different species in a community. Interspecific interactions have an impact on each individual’s life history

Explanation of Solution
In the same ecosystem, there are five ways by which species interact with each other. Species interaction has an impact on food, space, and availability of other
Based on effects on fitness like beneficial, detrimental or neutral the interspecific interaction can be classified into five groups
Competition interaction:-It refers to the interaction in which individuals of the same species interact with each other for limited resources. For example, competition between African lions and spotted hyenas for wildebeest.
Consumption Interaction:-It refers to the interaction in which organism obtains nutrition by harming othersor are themselves harmed. Predation is one of the parts of consumption interaction in which predator kills another species. The dependence of American bison on the grasses of plains of North America is the example of consumption interaction.
Mutualism interaction:-In this type of interaction,both the species benefit each other byproviding food or place to live. Interaction between plants and seed-dispersing animals is a type of mutualism.
Commensalism interaction:- This type of interaction influences only one participant and the other remains unaffected. For example,phalaenopsis orchid attaches to the trunk of a tree. The tree remains unaffected while orchid gets moisture and food from a tree.
Amenalism interaction:- It affects only one party of interaction that is harmed. For example, elephants crush insects while grazing. Amensal interaction is mostly unintentional.
Want to see more full solutions like this?
Chapter 40 Solutions
PRINCIPLES OF LIFE W ACHIEVE
- series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forward
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education





