Becker's World of the Cell (9th Edition)
9th Edition
ISBN: 9780321934925
Author: Jeff Hardin, Gregory Paul Bertoni
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 4, Problem 4.5PS
Telling Them Apart. Suggest a way to distinguish between the two elements in each of the following pairs.
(a) Bacterial cells; archaeal cells
(b) Rough ER; smooth ER
(c) Animal peroxisomes; leaf peroxisomes
(d) Peroxisomes; lysosomes
(e) Viruses; viroids
(f) Polio virus; herpes simplex virus
(g) Eukaryotic ribosomes; bacterial ribosomes
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Initiation. Bacterial protein synthesis is initiated by:
a. S-adenosylmethionyl tRNA
b. Methionyl TRNA
c. N-formylmethionyl tRNA
d. N10-formyltetrahydrofolateN"-formyltetrahydrofolate †RNA
„N10
match.
Don't copy paste.
Chapter 4 Solutions
Becker's World of the Cell (9th Edition)
Ch. 4 - Why do scientists currently believe that RNA,...Ch. 4 - You have discovered a new organism living in...Ch. 4 - If a scientist were studying a disease in which...Ch. 4 - Imagine that you are building an artificial...Ch. 4 - If viruses are nonliving particles, how can they...Ch. 4 - Wrong Again. For each of the following false...Ch. 4 - Prob. 4.2PSCh. 4 - Toward an Artificial Cell. Scientists have...Ch. 4 - Sentence Completion. Complete each of the...Ch. 4 - Telling Them Apart. Suggest a way to distinguish...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Genetics. How to identify what wrong with itarrow_forward"alive". Which student do you agree with? Explain your reasoning. (2) 3. Is the virus pictured below a naked virus or envelop virus? How can you tell? (2) 4. What is the function of the protein spikes on a virus? (1) 5. In your own words, describe how a virus multiplies. (6) hparrow_forwardAtlantic Thorny oyster. Trace its origin and evolutionary history or changes in the species. Describe its structures and their functions. What is the importance of this species to our environment? Give trivia about this species. Does this organism produce oxygen? Explain. What are the ancestral species of your chosen organism? Has this species been genetically engineered? If yes, in what way? How does this species reproduce? What organisms have similar structures to this species? Do these structures have the same function? Does the species have tissues, organs, and/or organ systems? What is its role in the flow of energy? Give at least a sentence to each question.arrow_forward
- True or false.arrow_forwardPen and Paper Exercise. A new virus was causing a localized epidemic in South Africa, affecting the population living along the Limpopo River Basin. Scientists working on the elucidation of more details about the virus have finally characterized it as a DNA virus (containing DNA as a genetic material and not RNA). Upon sequencing, a short DNA segment, speculated to be the structural gene of the viral genome responsible for viral replication, is shown with the following sequence: DNA sequence: 5'-CTACACTITATCGTTAATCTGCCAGAAGCACCCCTCCAGGTGTCTACTGTATGGTGTCGCCAT -3' A. "Transcribe" and form an RNA transcript based on the DNA sequence. B. If the RNA transcript formed is a messenger RNA, illustrate the amino acid sequence of the resulting polypeptide using the genetic code. *Please follow the proper directionality of both the RNA strand and the polypeptide. Indicate clearly and label correctly the ends of the molecules mentioned. C. What is/are the characteristic feature/s of the resulting…arrow_forwardTrue or False. Just write T if it is true and F if it is false. In E. coli both RNA and protein synthesis take place in the cytoplasm. Okazaki fragments are ssDNA CHAINS OF 100-200 nucleotides long, primed by very short RNA primers in bacteria. In eukaryotic gene, the coding sequences are known as introns while the intervening sequences are the exons. The central dogma refers to the fact that proteins are products of information encoded in RNA using a DNA intermediate. The ends of the linear chromosomes are maintained by telomerase to prevent it from shortening during mitosis. The Shine Delgarno sequence is where the RNA pol binds during transcription in prokaryotes The sigma subunit of the E. coli RNA polymerase confers specificity to transcription. Both DNA replication and transcription follow a 5’ to 3’ direction of polarity. Nucleosomes are the structural unit of chromatin. In the lagging strand, the enzyme X removes RNA primers attached by PRIMASE and this gap is then filled…arrow_forward
- match from given options.arrow_forwardILLUSTRATIONS. For each of the given proteins: Draw the final location of the following proteins after being translocated. • Label the organelle (as well as the organelle parts/compartments) and the cytosol (if necessary) in order to clearly depict the protein's location and orientation. • Label the amino and carboxyl ends of the protein. Below your drawing, indicate: a. the receptor/s b. the energy source c. if there is signal peptide cleavage or none A. Peroxisome: Class I PMP H₂N- ITS* *Internal targeting sequence -COOHarrow_forwardNeed help. do explainarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
Macromolecules | Classes and Functions; Author: 2 Minute Classroom;https://www.youtube.com/watch?v=V5hhrDFo8Vk;License: Standard youtube license