Human Anatomy Laboratory Manual With Cat Dissections (9th Edition)
9th Edition
ISBN: 9780135168035
Author: Elaine N. Marieb, Lori A. Smith
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Question
Chapter 4, Problem 2CRCAQ
Summary Introduction
To review:
The changes made by the sailors to prevent scurvy during long journeys.
Introduction:
The human body requires different nutrients in certain amounts in order to function properly. Vitamins and minerals are essential nutrients that are obtained through the diet. The deficiency of these vitamins may result in a number of disorders. Scurvy is a deficiency disorder that occurs due to lack of viamin C in the body.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Biology
You’re going to analyze 5 ul of your PCR product(out of 50 ul) on the gel. How much of 6X DNAloading buffer (dye) are you going to mix with yourPCR product to make final 1X concentration ofloading buffer in the PCR product-loading buffermixture?
Write the assignment on the title "GYMNOSPERMS" focus on the explanation of its important families, characters and reproduction.
Awnser these
Discussion Questions
Answer these discussion questions and submit them as part of your lab report.
Part A: The Effect of Temperature on Enzyme Activity
Graph the volume of oxygen produced against the temperature of the solution.
How is the oxygen production in 30 seconds related to the rate of the reaction?
At what temperature is the rate of reaction the highest? Lowest? Explain.
Why might the enzyme activity decrease at very high temperatures?
Why might a high fever be dangerous to humans?
What is the optimal temperature for enzymes in the human body?
Part B: The Effect of pH on Enzyme Activity
Graph the volume of oxygen produced against the pH of the solution.
At what pH is the rate of reaction the highest? Lowest? Explain.
Why does changing the pH affect the enzyme activity?
Research the enzyme catalase. What is its function in the human body?
What is the optimal pH for the following enzymes found in the human body? Explain. (catalase, lipase (in your stomach),…
Chapter 4 Solutions
Human Anatomy Laboratory Manual With Cat Dissections (9th Edition)
Ch. 4 - Describe the location of the apical region of an...Ch. 4 - Why are cuboidal or columnar cells found in...Ch. 4 - Prob. 3CYUCh. 4 - What type of gland are goblet cells? What do they...Ch. 4 - Prob. 5CYUCh. 4 - What feature distinguishes a simple exocrine gland...Ch. 4 - Prob. 7CYUCh. 4 - How do the intermediate �laments within...Ch. 4 - Prob. 9CYUCh. 4 - How do epithelial tissues differ from connective...
Ch. 4 - Distinguish the matrix of a connective tissue from...Ch. 4 - Which structural element of connective tissue...Ch. 4 - How does loose connective tissue differ from dense...Ch. 4 - Which type of connective tissue forms the...Ch. 4 - Which connective tissues contain collagen �bers?Ch. 4 - In which connective tissues are the cells located...Ch. 4 - Prob. 17CYUCh. 4 - Look at a photomicrograph of smooth muscle tissue...Ch. 4 - Which nerve cells function to transmit electrical...Ch. 4 - Distinguish between the terms striated and...Ch. 4 - Which tissues regenerate easily? Which tissues do...Ch. 4 - Is the scar tissue that creates a "scar" located...Ch. 4 - What causes the heat and swelling in an infected...Ch. 4 - Which embryonic layer or layers form epithelium?Ch. 4 - How do cancerous cells differ from other highly...Ch. 4 - An epithelium that has several cell layers, with...Ch. 4 - The type of gland that secretes products such as...Ch. 4 - Match the epithelial type named in column B with...Ch. 4 - ln connective tissue proper, the cell type that...Ch. 4 - Identify each of the cell surface features...Ch. 4 - Match each epithelial tissue in column B with its...Ch. 4 - For each connective tissue (CT) listed, indicate...Ch. 4 - The muscle tissue that is striated is (a) skeletal...Ch. 4 - Neuroglia (a) conduct electrical impulses, (b) are...Ch. 4 - Which of the following cells are not found.in a...Ch. 4 - The ground substance in connective tissue proper...Ch. 4 - Prob. 12RQCh. 4 - Prob. 13RQCh. 4 - Prob. 14RQCh. 4 - Prob. 15RQCh. 4 - Prob. 16RQCh. 4 - Prob. 17RQCh. 4 - Name the speci�c type of connective tissue being...Ch. 4 - Name the four classic symptoms of inflammation,...Ch. 4 - Prob. 20RQCh. 4 - Prob. 21RQCh. 4 - Of the four basic tissue types, which two develop...Ch. 4 - Prob. 23RQCh. 4 - Prob. 24RQCh. 4 - Prob. 25RQCh. 4 - Prob. 26RQCh. 4 - Prob. 1CRCAQCh. 4 - Prob. 2CRCAQCh. 4 - Three patients in an intensive care unit have...Ch. 4 - Prob. 4CRCAQCh. 4 - A patch of scar tissue that forms in the wall of...Ch. 4 - Ciliated epithelium is located in the bronchial...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Anwser these Discussion Questions: Part One Why were the plants kept in the dark prior to the experiment? Why is this important? Why is it important to boil the leaf? Explain why it was necessary to use boiling alcohol? What is the purpose of the iodine? Part Two What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out? What conclusions can you draw from this part of the lab? Part Three 7. In this experiment what was the purpose of adding the soda lime? 8. Why was a sealed bag placed around each plant? 9. What happened in the control plants? 10. What was the result on photosynthesis? Part Four 11. Why was a variegated leaf used in this experiment? !2. What conclusions can you draw about starch production in a variegated leaf?arrow_forwardHow did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forward
- What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forward
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Medical Terminology for Health Professions, Spira...Health & NutritionISBN:9781305634350Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. SchroederPublisher:Cengage Learning

Medical Terminology for Health Professions, Spira...
Health & Nutrition
ISBN:9781305634350
Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. Schroeder
Publisher:Cengage Learning
Human digestive system - How it works! (Animation); Author: Thomas Schwenke;https://www.youtube.com/watch?v=X3TAROotFfM;License: Standard Youtube License