The way by which ricin led to the death of Markov. Introduction: Ricin is a highly toxic protein that is produced from Ricinus communis . The toxicity of ricin is not only twice to the cyanide, but also has the lethal effects much higher than the venom of a cobra. The compound is found to be present in the endosperm of the seed.

Question

Want to see more full solutions like this?

Answer 1

Question

Chapter 38, Problem 1IQ

Summary Introduction

To determine: The way by which ricin led to the death of Markov.

Introduction: Ricin is a highly toxic protein that is produced from Ricinus communis. The toxicity of ricin is not only twice to the cyanide, but also has the lethal effects much higher than the venom of a cobra. The compound is found to be present in the endosperm of the seed.

Expert Solution & Answer

Explanation of Solution

Ricin is the combination of two compounds, ricin A and ricin B, in which ricin A is less toxic and found in the form of proricin. However, ricin B possesses the toxicity when disulfide bonds are hydrolyzed after the consumption of animals. The target site of ricin is the ribosome, which results in the inhibition of translation to form proteins.

Georgi Markov was a Bulgarian expatriate, who liked to do work as a novelist. On his way to London, a pinhead-sized metal from an umbrella pierced into the thigh of a person with intense pain. The metal contained approximately 0.2 mg of ricin compound, which injected into the skin of the person and caused the death of a person. The reason is that ricin led to stop the translation of protein and shutting down of metabolism due to the absence of enzymes (proteins).

Want to see more full solutions like this?

Subscribe now to access step-by-step solutions to millions of textbook problems written by subject matter experts!

Students have asked these similar questions

Question:- 1. Describe an assay that could measure the activity of adenylyl cyclase (AC).

Question one parts A though E a. True / False: Guanine to cytosine intermolecular interactions (hydrogen bonding) is stronger than adenine to thymine. b. What peptide would be made from the following DNA sequence? 5'ATCCCGGGTACTCACTCCCAT3' Start-Gly-Pro-Stop Start-Gly-Ser-Pro-Val-Arg-Val Start-Gly-Gly-Thr-lle-Arg Start-Arg-Arg-Gly-Gly c. Starting from the MRNA strand below - what peptide would be produced? Remember your start and stop codons...5'CCAUGCGGCAUACCAAAUUACUAAACUAGC3' Start-Arg-His-Thr-Lys-Leu-Leu-Asn-Stop Start-Asn-Leu-Leu-Lys-Thr-His-Arg-Stop Start-Arg-Lys-Leu-Asn-Stop Pro-Met-Arg-His-Leu-Leu-Asn d. Which type of RNA comprises over 80% of total cellular RNA? ribosomal RNA Messenger RNA Transfer RNA e. True / False - All of the DNA nucleotides are attached to the deoxyribose in the BETA configuration (at the anomeric carbon of the sugar). B (Ctrl) -

Questions and situational problems I. A particular gene codes for a mature mRNA containing 900 bases, which is translated into a 40 kDa protein. A mutant form of the gene created by a single point mutation yields an 830-base mature mRNA yielding a 37 kDa protein with modified enzymatic activity. The analysis shows that the mutation has resulted in a 22 amino acid deletion within the protein. What is the most likely effect of the mutation? Explain.

Answer 2

Question

Chapter 38, Problem 1IQ

Summary Introduction

To determine: The way by which ricin led to the death of Markov.

Introduction: Ricin is a highly toxic protein that is produced from Ricinus communis. The toxicity of ricin is not only twice to the cyanide, but also has the lethal effects much higher than the venom of a cobra. The compound is found to be present in the endosperm of the seed.

Expert Solution & Answer

Explanation of Solution

Ricin is the combination of two compounds, ricin A and ricin B, in which ricin A is less toxic and found in the form of proricin. However, ricin B possesses the toxicity when disulfide bonds are hydrolyzed after the consumption of animals. The target site of ricin is the ribosome, which results in the inhibition of translation to form proteins.

Georgi Markov was a Bulgarian expatriate, who liked to do work as a novelist. On his way to London, a pinhead-sized metal from an umbrella pierced into the thigh of a person with intense pain. The metal contained approximately 0.2 mg of ricin compound, which injected into the skin of the person and caused the death of a person. The reason is that ricin led to stop the translation of protein and shutting down of metabolism due to the absence of enzymes (proteins).

Want to see more full solutions like this?

Subscribe now to access step-by-step solutions to millions of textbook problems written by subject matter experts!

Answer 3

Question

Chapter 38, Problem 1IQ

Summary Introduction

To determine: The way by which ricin led to the death of Markov.

Introduction: Ricin is a highly toxic protein that is produced from Ricinus communis. The toxicity of ricin is not only twice to the cyanide, but also has the lethal effects much higher than the venom of a cobra. The compound is found to be present in the endosperm of the seed.

Expert Solution & Answer

Explanation of Solution

Ricin is the combination of two compounds, ricin A and ricin B, in which ricin A is less toxic and found in the form of proricin. However, ricin B possesses the toxicity when disulfide bonds are hydrolyzed after the consumption of animals. The target site of ricin is the ribosome, which results in the inhibition of translation to form proteins.

Georgi Markov was a Bulgarian expatriate, who liked to do work as a novelist. On his way to London, a pinhead-sized metal from an umbrella pierced into the thigh of a person with intense pain. The metal contained approximately 0.2 mg of ricin compound, which injected into the skin of the person and caused the death of a person. The reason is that ricin led to stop the translation of protein and shutting down of metabolism due to the absence of enzymes (proteins).

Want to see more full solutions like this?

Subscribe now to access step-by-step solutions to millions of textbook problems written by subject matter experts!

Answer 4

Question

Chapter 38, Problem 1IQ

Summary Introduction

To determine: The way by which ricin led to the death of Markov.

Introduction: Ricin is a highly toxic protein that is produced from Ricinus communis. The toxicity of ricin is not only twice to the cyanide, but also has the lethal effects much higher than the venom of a cobra. The compound is found to be present in the endosperm of the seed.

Expert Solution & Answer

Explanation of Solution

Ricin is the combination of two compounds, ricin A and ricin B, in which ricin A is less toxic and found in the form of proricin. However, ricin B possesses the toxicity when disulfide bonds are hydrolyzed after the consumption of animals. The target site of ricin is the ribosome, which results in the inhibition of translation to form proteins.

Georgi Markov was a Bulgarian expatriate, who liked to do work as a novelist. On his way to London, a pinhead-sized metal from an umbrella pierced into the thigh of a person with intense pain. The metal contained approximately 0.2 mg of ricin compound, which injected into the skin of the person and caused the death of a person. The reason is that ricin led to stop the translation of protein and shutting down of metabolism due to the absence of enzymes (proteins).

Want to see more full solutions like this?

Subscribe now to access step-by-step solutions to millions of textbook problems written by subject matter experts!

Answer 5

Chapter 38, Problem 1IQ

Summary Introduction

To determine: The way by which ricin led to the death of Markov.

Introduction: Ricin is a highly toxic protein that is produced from Ricinus communis. The toxicity of ricin is not only twice to the cyanide, but also has the lethal effects much higher than the venom of a cobra. The compound is found to be present in the endosperm of the seed.

Expert Solution & Answer

Explanation of Solution

Ricin is the combination of two compounds, ricin A and ricin B, in which ricin A is less toxic and found in the form of proricin. However, ricin B possesses the toxicity when disulfide bonds are hydrolyzed after the consumption of animals. The target site of ricin is the ribosome, which results in the inhibition of translation to form proteins.

Georgi Markov was a Bulgarian expatriate, who liked to do work as a novelist. On his way to London, a pinhead-sized metal from an umbrella pierced into the thigh of a person with intense pain. The metal contained approximately 0.2 mg of ricin compound, which injected into the skin of the person and caused the death of a person. The reason is that ricin led to stop the translation of protein and shutting down of metabolism due to the absence of enzymes (proteins).

Answer 6

Chapter 38, Problem 1IQ

Summary Introduction

To determine: The way by which ricin led to the death of Markov.

Introduction: Ricin is a highly toxic protein that is produced from Ricinus communis. The toxicity of ricin is not only twice to the cyanide, but also has the lethal effects much higher than the venom of a cobra. The compound is found to be present in the endosperm of the seed.

Expert Solution & Answer

Explanation of Solution

Ricin is the combination of two compounds, ricin A and ricin B, in which ricin A is less toxic and found in the form of proricin. However, ricin B possesses the toxicity when disulfide bonds are hydrolyzed after the consumption of animals. The target site of ricin is the ribosome, which results in the inhibition of translation to form proteins.

Georgi Markov was a Bulgarian expatriate, who liked to do work as a novelist. On his way to London, a pinhead-sized metal from an umbrella pierced into the thigh of a person with intense pain. The metal contained approximately 0.2 mg of ricin compound, which injected into the skin of the person and caused the death of a person. The reason is that ricin led to stop the translation of protein and shutting down of metabolism due to the absence of enzymes (proteins).

Answer 7

Chapter 38, Problem 1IQ

Summary Introduction

To determine: The way by which ricin led to the death of Markov.

Introduction: Ricin is a highly toxic protein that is produced from Ricinus communis. The toxicity of ricin is not only twice to the cyanide, but also has the lethal effects much higher than the venom of a cobra. The compound is found to be present in the endosperm of the seed.

Answer 8

Expert Solution & Answer

Explanation of Solution

Ricin is the combination of two compounds, ricin A and ricin B, in which ricin A is less toxic and found in the form of proricin. However, ricin B possesses the toxicity when disulfide bonds are hydrolyzed after the consumption of animals. The target site of ricin is the ribosome, which results in the inhibition of translation to form proteins.

Georgi Markov was a Bulgarian expatriate, who liked to do work as a novelist. On his way to London, a pinhead-sized metal from an umbrella pierced into the thigh of a person with intense pain. The metal contained approximately 0.2 mg of ricin compound, which injected into the skin of the person and caused the death of a person. The reason is that ricin led to stop the translation of protein and shutting down of metabolism due to the absence of enzymes (proteins).

Answer 9

Expert Solution & Answer

Answer 10

Expert Solution & Answer

Answer 11

Ch. 38.1 - Identify the compounds produced by the epidermis...Ch. 38.1 - Prob. 2LO Ch. 38.1 - Prob. 3LO Ch. 38.2 - Describe the role of secondary metabolites in...Ch. 38.2 - Prob. 2LO Ch. 38.2 - Prob. 3LO Ch. 38.3 - Prob. 1LO Ch. 38.3 - Prob. 2LO Ch. 38.4 - Prob. 1LO Ch. 38.4 - Prob. 2LO

Videos

Explanation of Solution

Want to see more full solutions like this?

Chapter 38 Solutions